ID: 1101775469

View in Genome Browser
Species Human (GRCh38)
Location 12:107789326-107789348
Sequence TTGTTTGCACAGAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101775463_1101775469 -7 Left 1101775463 12:107789310-107789332 CCCCAAGGCCTTTTACTTGTTTG No data
Right 1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG No data
1101775465_1101775469 -9 Left 1101775465 12:107789312-107789334 CCAAGGCCTTTTACTTGTTTGCA No data
Right 1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG No data
1101775464_1101775469 -8 Left 1101775464 12:107789311-107789333 CCCAAGGCCTTTTACTTGTTTGC No data
Right 1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG No data
1101775462_1101775469 -6 Left 1101775462 12:107789309-107789331 CCCCCAAGGCCTTTTACTTGTTT No data
Right 1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101775469 Original CRISPR TTGTTTGCACAGAGAGAGGG AGG Intergenic
No off target data available for this crispr