ID: 1101777859

View in Genome Browser
Species Human (GRCh38)
Location 12:107810007-107810029
Sequence GTCATCCATCAGGCCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101777857_1101777859 15 Left 1101777857 12:107809969-107809991 CCAGACAGTTTGTAAGTGGTGCT No data
Right 1101777859 12:107810007-107810029 GTCATCCATCAGGCCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101777859 Original CRISPR GTCATCCATCAGGCCTCAGT TGG Intergenic