ID: 1101785030

View in Genome Browser
Species Human (GRCh38)
Location 12:107875065-107875087
Sequence AATATGATGGACAGAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101785030_1101785038 23 Left 1101785030 12:107875065-107875087 CCAGATTTTCTGTCCATCATATT No data
Right 1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data
1101785030_1101785039 27 Left 1101785030 12:107875065-107875087 CCAGATTTTCTGTCCATCATATT No data
Right 1101785039 12:107875115-107875137 ATCTGCAGAAGGTAGCTGGTTGG No data
1101785030_1101785035 16 Left 1101785030 12:107875065-107875087 CCAGATTTTCTGTCCATCATATT No data
Right 1101785035 12:107875104-107875126 AAACATCCCTAATCTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101785030 Original CRISPR AATATGATGGACAGAAAATC TGG (reversed) Intergenic
No off target data available for this crispr