ID: 1101785031

View in Genome Browser
Species Human (GRCh38)
Location 12:107875078-107875100
Sequence GAGGTTGACGAGGAATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101785031_1101785040 23 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785040 12:107875124-107875146 AGGTAGCTGGTTGGTTCTGAAGG No data
1101785031_1101785035 3 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785035 12:107875104-107875126 AAACATCCCTAATCTGCAGAAGG No data
1101785031_1101785041 27 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785041 12:107875128-107875150 AGCTGGTTGGTTCTGAAGGTTGG No data
1101785031_1101785038 10 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data
1101785031_1101785039 14 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785039 12:107875115-107875137 ATCTGCAGAAGGTAGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101785031 Original CRISPR GAGGTTGACGAGGAATATGA TGG (reversed) Intergenic
No off target data available for this crispr