ID: 1101785038

View in Genome Browser
Species Human (GRCh38)
Location 12:107875111-107875133
Sequence CCTAATCTGCAGAAGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101785029_1101785038 29 Left 1101785029 12:107875059-107875081 CCTCTGCCAGATTTTCTGTCCAT No data
Right 1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data
1101785030_1101785038 23 Left 1101785030 12:107875065-107875087 CCAGATTTTCTGTCCATCATATT No data
Right 1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data
1101785032_1101785038 0 Left 1101785032 12:107875088-107875110 CCTCGTCAACCTCTCCAAACATC No data
Right 1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data
1101785031_1101785038 10 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data
1101785033_1101785038 -9 Left 1101785033 12:107875097-107875119 CCTCTCCAAACATCCCTAATCTG No data
Right 1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101785038 Original CRISPR CCTAATCTGCAGAAGGTAGC TGG Intergenic
No off target data available for this crispr