ID: 1101785039

View in Genome Browser
Species Human (GRCh38)
Location 12:107875115-107875137
Sequence ATCTGCAGAAGGTAGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101785034_1101785039 -10 Left 1101785034 12:107875102-107875124 CCAAACATCCCTAATCTGCAGAA No data
Right 1101785039 12:107875115-107875137 ATCTGCAGAAGGTAGCTGGTTGG No data
1101785032_1101785039 4 Left 1101785032 12:107875088-107875110 CCTCGTCAACCTCTCCAAACATC No data
Right 1101785039 12:107875115-107875137 ATCTGCAGAAGGTAGCTGGTTGG No data
1101785030_1101785039 27 Left 1101785030 12:107875065-107875087 CCAGATTTTCTGTCCATCATATT No data
Right 1101785039 12:107875115-107875137 ATCTGCAGAAGGTAGCTGGTTGG No data
1101785031_1101785039 14 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785039 12:107875115-107875137 ATCTGCAGAAGGTAGCTGGTTGG No data
1101785033_1101785039 -5 Left 1101785033 12:107875097-107875119 CCTCTCCAAACATCCCTAATCTG No data
Right 1101785039 12:107875115-107875137 ATCTGCAGAAGGTAGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101785039 Original CRISPR ATCTGCAGAAGGTAGCTGGT TGG Intergenic
No off target data available for this crispr