ID: 1101785041

View in Genome Browser
Species Human (GRCh38)
Location 12:107875128-107875150
Sequence AGCTGGTTGGTTCTGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101785034_1101785041 3 Left 1101785034 12:107875102-107875124 CCAAACATCCCTAATCTGCAGAA No data
Right 1101785041 12:107875128-107875150 AGCTGGTTGGTTCTGAAGGTTGG No data
1101785032_1101785041 17 Left 1101785032 12:107875088-107875110 CCTCGTCAACCTCTCCAAACATC No data
Right 1101785041 12:107875128-107875150 AGCTGGTTGGTTCTGAAGGTTGG No data
1101785033_1101785041 8 Left 1101785033 12:107875097-107875119 CCTCTCCAAACATCCCTAATCTG No data
Right 1101785041 12:107875128-107875150 AGCTGGTTGGTTCTGAAGGTTGG No data
1101785037_1101785041 -6 Left 1101785037 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG No data
Right 1101785041 12:107875128-107875150 AGCTGGTTGGTTCTGAAGGTTGG No data
1101785031_1101785041 27 Left 1101785031 12:107875078-107875100 CCATCATATTCCTCGTCAACCTC No data
Right 1101785041 12:107875128-107875150 AGCTGGTTGGTTCTGAAGGTTGG No data
1101785036_1101785041 -5 Left 1101785036 12:107875110-107875132 CCCTAATCTGCAGAAGGTAGCTG No data
Right 1101785041 12:107875128-107875150 AGCTGGTTGGTTCTGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101785041 Original CRISPR AGCTGGTTGGTTCTGAAGGT TGG Intergenic
No off target data available for this crispr