ID: 1101785977

View in Genome Browser
Species Human (GRCh38)
Location 12:107884011-107884033
Sequence CAGGGATAACGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101785977_1101785991 29 Left 1101785977 12:107884011-107884033 CCTTCCTCCTTCCGTTATCCCTG No data
Right 1101785991 12:107884063-107884085 TGGCACAGCTCTGGTCACTCTGG No data
1101785977_1101785989 20 Left 1101785977 12:107884011-107884033 CCTTCCTCCTTCCGTTATCCCTG No data
Right 1101785989 12:107884054-107884076 TCCTCTGGCTGGCACAGCTCTGG No data
1101785977_1101785988 9 Left 1101785977 12:107884011-107884033 CCTTCCTCCTTCCGTTATCCCTG No data
Right 1101785988 12:107884043-107884065 CAGTGCTGTGCTCCTCTGGCTGG No data
1101785977_1101785986 5 Left 1101785977 12:107884011-107884033 CCTTCCTCCTTCCGTTATCCCTG No data
Right 1101785986 12:107884039-107884061 TCCTCAGTGCTGTGCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101785977 Original CRISPR CAGGGATAACGGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr