ID: 1101795231

View in Genome Browser
Species Human (GRCh38)
Location 12:107966922-107966944
Sequence TCTAAGTTTTAGTAGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101795228_1101795231 22 Left 1101795228 12:107966877-107966899 CCTCTTGAGTAGCTGAGACTATA 0: 20
1: 761
2: 10567
3: 75586
4: 201821
Right 1101795231 12:107966922-107966944 TCTAAGTTTTAGTAGAAATAAGG No data
1101795227_1101795231 28 Left 1101795227 12:107966871-107966893 CCTCAGCCTCTTGAGTAGCTGAG 0: 306
1: 11074
2: 118967
3: 220585
4: 237287
Right 1101795231 12:107966922-107966944 TCTAAGTTTTAGTAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101795231 Original CRISPR TCTAAGTTTTAGTAGAAATA AGG Intergenic
No off target data available for this crispr