ID: 1101799442

View in Genome Browser
Species Human (GRCh38)
Location 12:108007982-108008004
Sequence AGGATGGCTTCAACTGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101799442_1101799449 17 Left 1101799442 12:108007982-108008004 CCCTTGCCAGTTGAAGCCATCCT No data
Right 1101799449 12:108008022-108008044 ATTCAAACCTATAAACATAGAGG No data
1101799442_1101799450 18 Left 1101799442 12:108007982-108008004 CCCTTGCCAGTTGAAGCCATCCT No data
Right 1101799450 12:108008023-108008045 TTCAAACCTATAAACATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101799442 Original CRISPR AGGATGGCTTCAACTGGCAA GGG (reversed) Intergenic
No off target data available for this crispr