ID: 1101799597

View in Genome Browser
Species Human (GRCh38)
Location 12:108009235-108009257
Sequence CACAGCCGAAAGCTTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101799590_1101799597 25 Left 1101799590 12:108009187-108009209 CCAGTCAGTTCACTGTGGCCATA No data
Right 1101799597 12:108009235-108009257 CACAGCCGAAAGCTTTCCATTGG No data
1101799589_1101799597 26 Left 1101799589 12:108009186-108009208 CCCAGTCAGTTCACTGTGGCCAT No data
Right 1101799597 12:108009235-108009257 CACAGCCGAAAGCTTTCCATTGG No data
1101799591_1101799597 7 Left 1101799591 12:108009205-108009227 CCATACATTTCCAGATTTCCAGG No data
Right 1101799597 12:108009235-108009257 CACAGCCGAAAGCTTTCCATTGG No data
1101799594_1101799597 -3 Left 1101799594 12:108009215-108009237 CCAGATTTCCAGGGAAGCCTCAC No data
Right 1101799597 12:108009235-108009257 CACAGCCGAAAGCTTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101799597 Original CRISPR CACAGCCGAAAGCTTTCCAT TGG Intergenic
No off target data available for this crispr