ID: 1101800048

View in Genome Browser
Species Human (GRCh38)
Location 12:108013826-108013848
Sequence CTGGAAGACCTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101800048_1101800052 -8 Left 1101800048 12:108013826-108013848 CCTTCCTCCTTCAGGTCTTCCAG No data
Right 1101800052 12:108013841-108013863 TCTTCCAGGACTAGTCTAGCTGG No data
1101800048_1101800055 24 Left 1101800048 12:108013826-108013848 CCTTCCTCCTTCAGGTCTTCCAG No data
Right 1101800055 12:108013873-108013895 TTCCCTTCTCTGCACTACTGAGG No data
1101800048_1101800053 -5 Left 1101800048 12:108013826-108013848 CCTTCCTCCTTCAGGTCTTCCAG No data
Right 1101800053 12:108013844-108013866 TCCAGGACTAGTCTAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101800048 Original CRISPR CTGGAAGACCTGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr