ID: 1101800245

View in Genome Browser
Species Human (GRCh38)
Location 12:108015730-108015752
Sequence CCACGTTACCAAGTGTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101800245_1101800248 1 Left 1101800245 12:108015730-108015752 CCTGGGAACACTTGGTAACGTGG No data
Right 1101800248 12:108015754-108015776 AAAGATGCAACACCAAGAGAGGG No data
1101800245_1101800250 22 Left 1101800245 12:108015730-108015752 CCTGGGAACACTTGGTAACGTGG No data
Right 1101800250 12:108015775-108015797 GGCATAAAACCAACGAAATGAGG No data
1101800245_1101800247 0 Left 1101800245 12:108015730-108015752 CCTGGGAACACTTGGTAACGTGG No data
Right 1101800247 12:108015753-108015775 AAAAGATGCAACACCAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101800245 Original CRISPR CCACGTTACCAAGTGTTCCC AGG (reversed) Intergenic
No off target data available for this crispr