ID: 1101800929

View in Genome Browser
Species Human (GRCh38)
Location 12:108021499-108021521
Sequence ATGAAGGAGCAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101800929_1101800938 23 Left 1101800929 12:108021499-108021521 CCTTCCTCCTCCTGCTCCTTCAT No data
Right 1101800938 12:108021545-108021567 TCCCATGGGAGCAGGCTCAGTGG No data
1101800929_1101800935 8 Left 1101800929 12:108021499-108021521 CCTTCCTCCTCCTGCTCCTTCAT No data
Right 1101800935 12:108021530-108021552 TCTGAATCTAGAGTTTCCCATGG No data
1101800929_1101800937 15 Left 1101800929 12:108021499-108021521 CCTTCCTCCTCCTGCTCCTTCAT No data
Right 1101800937 12:108021537-108021559 CTAGAGTTTCCCATGGGAGCAGG No data
1101800929_1101800936 9 Left 1101800929 12:108021499-108021521 CCTTCCTCCTCCTGCTCCTTCAT No data
Right 1101800936 12:108021531-108021553 CTGAATCTAGAGTTTCCCATGGG No data
1101800929_1101800940 24 Left 1101800929 12:108021499-108021521 CCTTCCTCCTCCTGCTCCTTCAT No data
Right 1101800940 12:108021546-108021568 CCCATGGGAGCAGGCTCAGTGGG No data
1101800929_1101800942 29 Left 1101800929 12:108021499-108021521 CCTTCCTCCTCCTGCTCCTTCAT No data
Right 1101800942 12:108021551-108021573 GGGAGCAGGCTCAGTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101800929 Original CRISPR ATGAAGGAGCAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr