ID: 1101803152

View in Genome Browser
Species Human (GRCh38)
Location 12:108040169-108040191
Sequence CTCATTCAAAACATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101803148_1101803152 27 Left 1101803148 12:108040119-108040141 CCCAAATCTTTCTCTTAACCTGT No data
Right 1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG No data
1101803149_1101803152 26 Left 1101803149 12:108040120-108040142 CCAAATCTTTCTCTTAACCTGTA No data
Right 1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG No data
1101803150_1101803152 9 Left 1101803150 12:108040137-108040159 CCTGTAACACTCCTGATAAATTG No data
Right 1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG No data
1101803151_1101803152 -2 Left 1101803151 12:108040148-108040170 CCTGATAAATTGATGCATTTTCT No data
Right 1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101803152 Original CRISPR CTCATTCAAAACATATTTAT TGG Intergenic
No off target data available for this crispr