ID: 1101803278

View in Genome Browser
Species Human (GRCh38)
Location 12:108041468-108041490
Sequence CTGAACATACAAATGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101803270_1101803278 28 Left 1101803270 12:108041417-108041439 CCCCACTGGTATTGATGAAGCTT No data
Right 1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG No data
1101803272_1101803278 26 Left 1101803272 12:108041419-108041441 CCACTGGTATTGATGAAGCTTCT No data
Right 1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG No data
1101803271_1101803278 27 Left 1101803271 12:108041418-108041440 CCCACTGGTATTGATGAAGCTTC No data
Right 1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101803278 Original CRISPR CTGAACATACAAATGGACAG TGG Intergenic
No off target data available for this crispr