ID: 1101805937

View in Genome Browser
Species Human (GRCh38)
Location 12:108063751-108063773
Sequence AAGAGCAATGCATAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101805933_1101805937 18 Left 1101805933 12:108063710-108063732 CCGTTGGCTCTGATCTGGCTTTG No data
Right 1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG No data
1101805932_1101805937 19 Left 1101805932 12:108063709-108063731 CCCGTTGGCTCTGATCTGGCTTT No data
Right 1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101805937 Original CRISPR AAGAGCAATGCATAGGTGGA TGG Intergenic
No off target data available for this crispr