ID: 1101805937 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:108063751-108063773 |
Sequence | AAGAGCAATGCATAGGTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1101805933_1101805937 | 18 | Left | 1101805933 | 12:108063710-108063732 | CCGTTGGCTCTGATCTGGCTTTG | No data | ||
Right | 1101805937 | 12:108063751-108063773 | AAGAGCAATGCATAGGTGGATGG | No data | ||||
1101805932_1101805937 | 19 | Left | 1101805932 | 12:108063709-108063731 | CCCGTTGGCTCTGATCTGGCTTT | No data | ||
Right | 1101805937 | 12:108063751-108063773 | AAGAGCAATGCATAGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1101805937 | Original CRISPR | AAGAGCAATGCATAGGTGGA TGG | Intergenic | ||
No off target data available for this crispr |