ID: 1101812019

View in Genome Browser
Species Human (GRCh38)
Location 12:108115532-108115554
Sequence TGCCCACTCATGACAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101812019_1101812025 11 Left 1101812019 12:108115532-108115554 CCTCCCTCTGTCATGAGTGGGCA No data
Right 1101812025 12:108115566-108115588 TGTTCACCAGCTTCTGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101812019 Original CRISPR TGCCCACTCATGACAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr