ID: 1101813680

View in Genome Browser
Species Human (GRCh38)
Location 12:108129503-108129525
Sequence ACTGCGGGTGCCCCGAGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101813680_1101813690 13 Left 1101813680 12:108129503-108129525 CCGCGGCTCGGGGCACCCGCAGT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1101813690 12:108129539-108129561 GCGCCAGGCTCACAGGAGCCCGG 0: 1
1: 0
2: 2
3: 21
4: 281
1101813680_1101813687 6 Left 1101813680 12:108129503-108129525 CCGCGGCTCGGGGCACCCGCAGT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1101813687 12:108129532-108129554 CGCCCGAGCGCCAGGCTCACAGG 0: 1
1: 0
2: 0
3: 10
4: 81
1101813680_1101813683 -2 Left 1101813680 12:108129503-108129525 CCGCGGCTCGGGGCACCCGCAGT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1101813683 12:108129524-108129546 GTGCCGCCCGCCCGAGCGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101813680 Original CRISPR ACTGCGGGTGCCCCGAGCCG CGG (reversed) Intronic