ID: 1101816633

View in Genome Browser
Species Human (GRCh38)
Location 12:108150853-108150875
Sequence CTGGAAAAAAGGCCCCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101816629_1101816633 12 Left 1101816629 12:108150818-108150840 CCAGCAGGCACTTGAGCAGACCT 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1101816633 12:108150853-108150875 CTGGAAAAAAGGCCCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 159
1101816631_1101816633 -8 Left 1101816631 12:108150838-108150860 CCTCTGCGAGAAGCTCTGGAAAA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1101816633 12:108150853-108150875 CTGGAAAAAAGGCCCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 159
1101816628_1101816633 13 Left 1101816628 12:108150817-108150839 CCCAGCAGGCACTTGAGCAGACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1101816633 12:108150853-108150875 CTGGAAAAAAGGCCCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101816633 Original CRISPR CTGGAAAAAAGGCCCCTTGT TGG Intronic
902643488 1:17781625-17781647 CTGGAAATAAGGATCTTTGTAGG - Intronic
903041608 1:20534911-20534933 CTTGAAAAAAGGCTGCGTGTTGG - Intergenic
911104939 1:94122146-94122168 ATGGCAAAAAGGCTCCTTGGAGG + Intergenic
913514364 1:119590469-119590491 CTGGATTAAAGGCCCCTCCTTGG - Intergenic
915513713 1:156400870-156400892 GGGGAAGAGAGGCCCCTTGTTGG - Intergenic
917460282 1:175223355-175223377 CTGGAAAAATGTCCCCTGCTGGG - Intergenic
1063603218 10:7500599-7500621 CTGGAAAAAAGCCTCCGGGTGGG + Intergenic
1063808629 10:9678143-9678165 CTGGCAAAAAGGCCTCTGTTAGG + Intergenic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1065656028 10:27950992-27951014 CTTGAAAAAAGTTCCCATGTCGG + Intronic
1066144752 10:32545939-32545961 CTGGAAAAAATGACGCATGTTGG + Intronic
1069369631 10:67733443-67733465 CTTGAATAAAGGTCCCTTGGTGG - Intergenic
1069743466 10:70700140-70700162 CTGGAAGACAGGCCTCCTGTGGG + Intronic
1069924588 10:71839537-71839559 CTTTAAAAAAGTCCCATTGTGGG - Intronic
1071039593 10:81290484-81290506 CAGGAATAAAGCCCACTTGTTGG - Intergenic
1071228417 10:83558770-83558792 ATGGAACAAAGGCCCTTGGTGGG - Intergenic
1072332510 10:94367775-94367797 CTTGAGAAAAGGCCCCCAGTTGG + Intergenic
1072479099 10:95793374-95793396 ATGGGGAAAAGGCCCCTGGTTGG + Intronic
1072541942 10:96405232-96405254 CTGGAGAAAAGCCCCCCTTTTGG - Exonic
1072622144 10:97087211-97087233 CTGGAGAACAGGCCCCCTGGAGG - Intronic
1072663859 10:97380236-97380258 CTGGAAAAAAGGAACCCTGGTGG - Intronic
1072726422 10:97816788-97816810 CTGGAATCATGGCCCTTTGTAGG + Intergenic
1073189947 10:101644055-101644077 GGGGAACAAAGGCCCCCTGTGGG - Intronic
1073230642 10:101966635-101966657 CTGCAAAAAAGGTTCCTTGTGGG - Intronic
1073889752 10:108086262-108086284 CTGAAGGAAAGGCCACTTGTGGG + Intergenic
1078663056 11:13302555-13302577 CTGGAAAATTGGGCCCATGTGGG + Intronic
1078793206 11:14566009-14566031 CTGGAACAAAGGCCCCATGGTGG + Intronic
1079675470 11:23221022-23221044 CTGAGGAAAAGGACCCTTGTAGG - Intergenic
1081406817 11:42707806-42707828 CTGGGAAAAAGTCCCCAAGTAGG + Intergenic
1081966792 11:47174985-47175007 CTGGGAAAACGGTTCCTTGTGGG + Intronic
1084760258 11:71266325-71266347 CTGGGTAAACGGCCCCTTGGAGG + Intergenic
1084997357 11:72994288-72994310 CTTCTAAAAAGACCCCTTGTGGG + Intronic
1086222339 11:84463403-84463425 CTCAAGAAAAGGCCTCTTGTAGG + Intronic
1087882187 11:103430156-103430178 CTTAAAAAATGGCCACTTGTAGG - Intronic
1088181404 11:107116816-107116838 CTGGAAAATAAGCCCCTAGGTGG + Intergenic
1090424658 11:126599017-126599039 CTGTTATAAAGTCCCCTTGTGGG + Intronic
1090984165 11:131750987-131751009 ATGGAGAAAAAGCCCCATGTGGG - Intronic
1091451812 12:576693-576715 CTGGCAAAACGGCCTCTTGCAGG - Intronic
1093601754 12:21034734-21034756 GTGGAAAAAAGGCACACTGTTGG - Intronic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1101816633 12:108150853-108150875 CTGGAAAAAAGGCCCCTTGTTGG + Intronic
1102283388 12:111635902-111635924 CTGGAAAAGAGGCCCCTCATAGG + Intergenic
1102460695 12:113097867-113097889 CTGGGCAACAGGCCCCTGGTTGG - Exonic
1103878607 12:124148688-124148710 CTGGTCAACTGGCCCCTTGTCGG + Intronic
1104522458 12:129488006-129488028 AGGGAGAAACGGCCCCTTGTTGG + Intronic
1106966446 13:35076643-35076665 GTGGAAAAAAGGCACCTTTTTGG + Intronic
1111907731 13:94274922-94274944 CAGGATAAATGGCCCCTTGGTGG - Intronic
1112370602 13:98789805-98789827 CTGGACCCAAGGCCTCTTGTGGG + Intergenic
1112841046 13:103578207-103578229 GTGGAAAAAAAGCCATTTGTTGG - Intergenic
1113824932 13:113244984-113245006 TTGGCAAAAAGACTCCTTGTTGG + Exonic
1116823831 14:49652071-49652093 CTGGAAAAAGGGACCCTCATTGG - Intronic
1119679173 14:76579046-76579068 TTGGAAAAGACTCCCCTTGTGGG - Intergenic
1119688321 14:76650977-76650999 GAGGAAAAAAGGCCACATGTTGG - Intergenic
1122047206 14:99032731-99032753 TTGGAAAAAAGGCTTCCTGTGGG + Intergenic
1122277682 14:100603638-100603660 CGGGAACAAAGGCCACTTGTGGG - Intergenic
1127819552 15:62643049-62643071 CTGGCAAAAAGGACACTTGTTGG - Intronic
1130573748 15:85072291-85072313 CTGGAAAAAAGGCCACATAATGG - Intronic
1130701451 15:86186642-86186664 CTGCCACAAAGGCCTCTTGTTGG + Intronic
1131403229 15:92143151-92143173 ATGAAAAATGGGCCCCTTGTGGG - Intronic
1134052711 16:11147941-11147963 ATGGAAAAAAGGCACGTTTTAGG - Intronic
1139911524 16:70400245-70400267 AGGGAGAAAAGGCCACTTGTAGG + Exonic
1141530656 16:84644311-84644333 AAGGAAAAAAGGCACCATGTTGG + Intergenic
1141715349 16:85723877-85723899 CTGGAAACCAGGCCCCTGGGAGG + Intronic
1142183858 16:88685384-88685406 CTGGGATAAAGGCCTCTTGGCGG + Intronic
1144029086 17:11303928-11303950 CTGGAAACATGGCCTCTTCTCGG - Intronic
1144396506 17:14849149-14849171 CTGATAAAAAGCCCCCTTCTTGG - Intergenic
1150992567 17:70276888-70276910 CTGTGAAAATGGCTCCTTGTGGG + Intergenic
1152069851 17:78129002-78129024 CTGGAAATATTGCCCCTTTTTGG - Intronic
1152716914 17:81904673-81904695 CTGCAAACCAGGCACCTTGTAGG + Exonic
1153724171 18:7938004-7938026 CTGGAAAAATGGCCAATTCTAGG - Intronic
1155038580 18:22045790-22045812 ATGAAAAAATGGCCCCCTGTGGG + Intergenic
1155302034 18:24439063-24439085 CTGGAAAAATGTCCTCTTCTGGG + Intronic
1159568405 18:70083146-70083168 CTGGTATCAAGGCCCCTGGTAGG + Intronic
1160025697 18:75213715-75213737 TTGGAAAAAAGTCGCCTTGACGG - Intronic
1160308345 18:77762851-77762873 GTGGAACAAAAGCCCCTTTTTGG + Intergenic
1162343593 19:10106778-10106800 CTGGAAAAAAAGACCCTCATGGG + Intronic
1163188048 19:15653494-15653516 CTGGAAAATAGATCCCTGGTTGG - Intronic
1165251299 19:34538156-34538178 CTGGAAAAAAGGCCAACTGAAGG - Intergenic
1167056855 19:47116703-47116725 AAGGAAAAAAGGTCTCTTGTTGG - Intronic
928285746 2:29988621-29988643 TGTGAAAAAAGGCCCTTTGTAGG + Intergenic
929172434 2:38945354-38945376 CTTGAAAATAGGCCACTCGTGGG - Intronic
934081648 2:88473477-88473499 ATGGAAAAAAGGCTCCCTATGGG - Intergenic
934705236 2:96472803-96472825 CTGCAAGACAGGCACCTTGTAGG - Intergenic
936346080 2:111676316-111676338 CTGGAAAACAGCCCCCATTTGGG - Intergenic
938180832 2:129180266-129180288 ATGGAAAAAATGACCCTAGTGGG - Intergenic
938773656 2:134522240-134522262 GTGGAAAACAAGCCCCTAGTTGG - Intronic
938925880 2:136041892-136041914 CAGGAAAAAATGCACCTTGCTGG + Intergenic
939497883 2:142946027-142946049 TTGGAAAAAAGGCCAGGTGTGGG - Intronic
942035044 2:172002623-172002645 ATGGAGAAAGGGCCCCTTTTTGG + Intronic
942569223 2:177296504-177296526 CTGGATAAAATGCTCCTTGAAGG - Intronic
942604832 2:177679690-177679712 CTGGAGAAAAGGCAGCCTGTAGG + Intronic
944198781 2:197083546-197083568 CTAGAAAACAGGCCTGTTGTTGG + Intronic
945916391 2:215708840-215708862 CTGGAATAAAGGATTCTTGTAGG + Intergenic
1171938514 20:31300795-31300817 CAGGAAAAAAGCCCACTAGTTGG + Intergenic
1173790733 20:45826367-45826389 TTGGAGAAAAGGCCCCTCATGGG + Intronic
1173922540 20:46757182-46757204 CTGGCAAACAGGCCCCCAGTGGG - Intergenic
1175761243 20:61563330-61563352 TTGGGAAGAAGGACCCTTGTAGG + Intronic
1177376725 21:20279916-20279938 CAGGGAGAAAGGCCGCTTGTGGG - Intergenic
1180995614 22:19963787-19963809 CTGGAAAAAGGGCCGGCTGTGGG + Intronic
1181037733 22:20178051-20178073 CTGGAAAACAGGACCCCTGAAGG - Intergenic
1182795993 22:32992057-32992079 TTGGAAAAAAGGTCACTTGGAGG + Intronic
1183316905 22:37141896-37141918 CTGAAAAACAAGGCCCTTGTTGG + Intronic
1184204730 22:42994729-42994751 CTGGAAAAAGGGCCCCGGGCAGG + Intronic
1185172648 22:49302782-49302804 ATGGTAAACAGGCCCCGTGTGGG - Intergenic
949863150 3:8524545-8524567 CTGTAAAAAACTCTCCTTGTAGG + Intronic
950172970 3:10852127-10852149 CTGCAACAAAGGCCACTTGAGGG - Intronic
950737799 3:15024723-15024745 CTGGAAAAAATCCCCCTCCTTGG - Intronic
958738613 3:98040714-98040736 CTGGAAAACAGGGACCTTATTGG - Intergenic
961151029 3:124637955-124637977 CTGGTGAAAGGGCCCCTTTTTGG + Intronic
961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG + Intergenic
963728629 3:148948970-148948992 CTGGAAGAAAGGCCCTGTATGGG - Intergenic
965684972 3:171293002-171293024 CTGGAAAAAAGGACTTTAGTGGG - Intronic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
968478534 4:824102-824124 CTGGAAGGAAGCCCCCTTGGGGG + Intronic
970254754 4:14155731-14155753 CTGGAATAGAAGCCCTTTGTGGG - Intergenic
971699034 4:29944289-29944311 CTGGAACACAGGCCCTTTCTGGG - Intergenic
975612860 4:76218553-76218575 CTGGAAAAGATTCCCCTAGTTGG - Intronic
977138617 4:93338832-93338854 CAGGAAAAAAGGCTCTTTGGGGG - Intronic
978131098 4:105198658-105198680 CTGGAAAAAATATGCCTTGTAGG + Intronic
979461920 4:120993493-120993515 CTGGAATAAAGGCCTATTGAAGG + Intergenic
980859376 4:138481200-138481222 ATGGAAAACTGGCCCCTGGTTGG + Intergenic
981447952 4:144862178-144862200 CTGGAGAAAAGGCCTATTGCTGG + Intergenic
988240997 5:28609171-28609193 ATGGAAAAATGTCCCCTTCTAGG + Intergenic
989420469 5:41234126-41234148 CTGGAAAGAATGACCCCTGTGGG - Intronic
992958189 5:81931913-81931935 CTGGAAAAAAGAACCATTGAAGG - Intergenic
993511272 5:88774123-88774145 CTGGGGAAAAGGCTCCTTGCAGG + Intronic
997781715 5:136666345-136666367 CTGGAAAAATGGTCCATTGAGGG - Intergenic
1001222260 5:169911156-169911178 CTGACAAAATGGCCCCTAGTCGG + Intronic
1001223858 5:169927185-169927207 CTTGAAAAAAGGCCCCTGGCTGG + Intronic
1004344125 6:14832629-14832651 CTGGAGAATAGGCCCCTGGCTGG + Intergenic
1006566395 6:34961458-34961480 AAGGAAAAAAGGCCTCTGGTTGG + Intronic
1007087265 6:39157602-39157624 CTTGCAAAAAGGCACCTTATGGG - Intergenic
1007144306 6:39612204-39612226 CTGAATAAAAGGTCCCTTGACGG + Intronic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1010205981 6:73322931-73322953 CTGCACAAAGAGCCCCTTGTTGG - Intergenic
1013827867 6:114236163-114236185 CTGAAAAAAATGCCCATAGTAGG - Intronic
1015019034 6:128449438-128449460 CTGGAAAAAAGTGTCCTTCTAGG - Intronic
1018378741 6:163238606-163238628 CTGGCTAAAATGCCCCATGTGGG - Intronic
1022825962 7:34014178-34014200 CTACAAAAAAGGCACATTGTGGG + Intronic
1025604868 7:63032153-63032175 CTGGGGAAAGGGCCCCTTGAAGG + Intergenic
1026843223 7:73682681-73682703 CAGGAAAAAAGGCCGTTTCTGGG + Exonic
1027129277 7:75579696-75579718 CTGGAAAAGAGGCCAGTAGTAGG + Intronic
1027965470 7:85000188-85000210 CTGTAAAGAAGGCCACTTGATGG - Intronic
1029676495 7:102073023-102073045 CTGGAAAACACTCCCCTTCTGGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1034397448 7:150838024-150838046 TTGAAAGAAATGCCCCTTGTAGG + Intronic
1035192213 7:157180874-157180896 CTGGAGAAAAGGCTGATTGTAGG + Intronic
1035751537 8:2000559-2000581 CTTGAAAAGAGTCCCCTTATGGG - Exonic
1037273379 8:17154034-17154056 CGGGAGAAAAGCCCCCTTGCTGG - Intergenic
1038665582 8:29534735-29534757 CTGGAAATAAGGCCCATATTTGG - Intergenic
1039948267 8:42148563-42148585 CTGGAAGAGAGGCCCCTTGCGGG - Intergenic
1042132701 8:65604341-65604363 ATGGAAAACTGGCCCCTTGTTGG + Exonic
1042258243 8:66829052-66829074 CTGAAAAAAAGCACCCTTGCAGG + Intronic
1044917435 8:97130135-97130157 CTGGTAAAAAGGCCTCATGATGG - Intronic
1048154368 8:131930260-131930282 CTGGAAAAAAGGAACCTAGTAGG - Intronic
1048368167 8:133756627-133756649 CTGGAAAAAAGGAACCATCTGGG + Intergenic
1050386606 9:5097439-5097461 CTGGAAAAAAGGAGCCATTTGGG + Intronic
1051256599 9:15220046-15220068 TTGGAAAAAAGGTTCCTTTTTGG - Intronic
1051958217 9:22725254-22725276 CTGGAGAAAAGGCATCTTATCGG - Intergenic
1054867360 9:70016161-70016183 CTGAACAAAAGGCCACTTTTAGG - Intergenic
1055832278 9:80395179-80395201 GTGGAAAATATGCCCCATGTGGG - Intergenic
1060925080 9:127450697-127450719 GTGAAAAAAATGCCCCTTGGAGG + Intronic
1186560202 X:10603598-10603620 CTGGAAAAAATGCCCCCAGAAGG + Intronic
1187809886 X:23164088-23164110 CTGGAAAAAAAGCACATTTTTGG - Intergenic
1194090725 X:89580158-89580180 CGAGGAAATAGGCCCCTTGTAGG + Intergenic
1196101772 X:111854219-111854241 CTAGAAAACAGGCCTCTTCTGGG - Intronic
1196936705 X:120737534-120737556 CTGGAAAAAGTGCTCCTTTTTGG + Intergenic
1198509687 X:137337703-137337725 CTGGAAAAAAGTCCATTTGCAGG - Intergenic
1199212454 X:145229291-145229313 CTCGCTAAAAGGCCCATTGTTGG - Intergenic
1200443377 Y:3236218-3236240 CAAGGAAACAGGCCCCTTGTAGG + Intergenic