ID: 1101817125

View in Genome Browser
Species Human (GRCh38)
Location 12:108153773-108153795
Sequence GGCCAACGGGAGGCCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 15, 3: 56, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101817125_1101817134 21 Left 1101817125 12:108153773-108153795 CCTGCCAGGGCCTCCCGTTGGCC 0: 1
1: 0
2: 15
3: 56
4: 390
Right 1101817134 12:108153817-108153839 AAGCAGAAAGCTCATTGATGTGG 0: 1
1: 0
2: 1
3: 21
4: 275
1101817125_1101817131 -3 Left 1101817125 12:108153773-108153795 CCTGCCAGGGCCTCCCGTTGGCC 0: 1
1: 0
2: 15
3: 56
4: 390
Right 1101817131 12:108153793-108153815 GCCAAACTCTAGTGGAAGTTAGG 0: 1
1: 0
2: 1
3: 6
4: 74
1101817125_1101817133 -2 Left 1101817125 12:108153773-108153795 CCTGCCAGGGCCTCCCGTTGGCC 0: 1
1: 0
2: 15
3: 56
4: 390
Right 1101817133 12:108153794-108153816 CCAAACTCTAGTGGAAGTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101817125 Original CRISPR GGCCAACGGGAGGCCCTGGC AGG (reversed) Intronic
900013695 1:135556-135578 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900043765 1:491539-491561 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900044483 1:494562-494584 GGCCGACGGGAGGCAGAGGCTGG + Intergenic
900065202 1:726542-726564 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900188902 1:1345147-1345169 GGTCTTCGTGAGGCCCTGGCTGG - Intronic
900242750 1:1624809-1624831 GATCCTCGGGAGGCCCTGGCGGG - Exonic
900374674 1:2348024-2348046 GGCCACGGGGAAGCCCAGGCTGG - Intronic
900409681 1:2507013-2507035 GGCCACCGGCAGGCCCTGCATGG + Intergenic
900857783 1:5199914-5199936 GGCCAACGGGAAGTACTTGCAGG - Intergenic
901157755 1:7151744-7151766 GACCATTGGGAGGCCCTGGAGGG + Intronic
901242655 1:7704294-7704316 GGGGAACGGGAGGCCCGCGCGGG + Intronic
901642244 1:10698677-10698699 GGCCAAGGAGGGTCCCTGGCAGG + Intronic
901645545 1:10715114-10715136 GGCCAACCGGAGGCCAGGGTGGG - Intronic
902294490 1:15457153-15457175 GCCCAACAGCTGGCCCTGGCAGG + Exonic
902297313 1:15476524-15476546 GCCCAACAGCTGGCCCTGGCAGG + Exonic
902514098 1:16980622-16980644 GGCCAAGGGGCGGCTCCGGCGGG - Exonic
902728463 1:18352731-18352753 CCCCAACTGGAGGCTCTGGCTGG - Intronic
902778403 1:18689392-18689414 GGGTAACTGGAAGCCCTGGCAGG + Intronic
902840941 1:19073511-19073533 GCCCAGCTGGAAGCCCTGGCAGG - Intergenic
903302051 1:22386155-22386177 GGCCACAGGGAGGCGATGGCAGG - Intergenic
904354956 1:29932959-29932981 GCCCAAGCGGAGGTCCTGGCTGG - Intergenic
904538285 1:31215688-31215710 GCCCAACCGAAGGCCCTGGGAGG + Intronic
906208368 1:43998956-43998978 GGCCACCCAGAGGGCCTGGCGGG + Intronic
907524440 1:55046035-55046057 AGCCAATGGGAGGCACTAGCAGG - Intronic
908036677 1:60061993-60062015 GGCCAATGGGTAGCCCTGGCAGG + Intronic
909559220 1:76991054-76991076 GGCCAATGAGAAGCACTGGCAGG - Intronic
912205161 1:107500617-107500639 GGCCAATGAGAGGCTCTGGCAGG - Intergenic
912244141 1:107943362-107943384 GGCCAAATGAAGGCCCTGGAGGG - Intronic
913119446 1:115726303-115726325 GGAAAACAGGAGGCCCTGGCTGG - Intronic
913975152 1:143450029-143450051 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914069545 1:144275645-144275667 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914109610 1:144690709-144690731 GGCCAACTGGACGCCCTGGGAGG + Intergenic
914941449 1:152026805-152026827 GACCAACAGGAGGCACTTGCAGG + Intergenic
915590526 1:156867917-156867939 GGCCATTGGGAGGCCGAGGCGGG - Intronic
916989908 1:170231800-170231822 GGCCAAAGGGAAGCCCTGGCAGG + Intergenic
917969279 1:180196843-180196865 GGCCAGCTGGAGGCCCGAGCTGG + Exonic
918409965 1:184248272-184248294 GGCCAATTCAAGGCCCTGGCAGG - Intergenic
918437733 1:184533774-184533796 GTTCCACAGGAGGCCCTGGCCGG + Intronic
919944442 1:202309209-202309231 GGCCAGCTGGAGACCCTGGAGGG + Intronic
922101012 1:222476817-222476839 GGCCGACGGGAGGCAGAGGCTGG + Intergenic
922262111 1:223951955-223951977 GGCCGACGGGAGGCACAGGCTGG + Intergenic
922505540 1:226123437-226123459 CTCCAAGGGGAGGCCCTGCCAGG + Intergenic
922560343 1:226565064-226565086 AGCCAATGGGAGGCACTGGTAGG + Intronic
922733605 1:227967855-227967877 GGCCGACGGGAGGCAGAGGCTGG - Intergenic
922734945 1:227973760-227973782 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
924343938 1:243056934-243056956 GGCCGACGGGAGGCAGAGGCTGG + Intergenic
1064532367 10:16323298-16323320 AGCCAATGGGAAGCACTGGCAGG - Intergenic
1064552492 10:16519009-16519031 GGCCACCAGGAGGCACTGACAGG - Intronic
1066733185 10:38451376-38451398 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1067749401 10:48960163-48960185 GGCCAGTGGGAGTCCCTGGGAGG - Intronic
1068762946 10:60733179-60733201 GGCGGGCGGGAGGCCCGGGCCGG - Intronic
1069785208 10:70983469-70983491 TGCCACCCTGAGGCCCTGGCAGG - Intergenic
1069861084 10:71472192-71472214 AGCCAACAGGAGGCCCTGGCAGG + Intronic
1070377610 10:75848963-75848985 GACCAATGGGAGGCCCTGTCAGG + Intronic
1070999126 10:80814234-80814256 GGCCAACGGGAGTTCCGGGTGGG + Intergenic
1071370292 10:84944358-84944380 GGCCAATGAGAGGCACTGGCAGG - Intergenic
1072105990 10:92274592-92274614 GGACTTCGGGAGGCCCAGGCGGG + Intronic
1073565067 10:104527972-104527994 GTCCAATGGGAGGGGCTGGCAGG + Intergenic
1073714422 10:106086618-106086640 GGCCAATGGGAGACACTGGCAGG + Intergenic
1074111210 10:110423854-110423876 GGCCAGGGGCAGGCCCTGGGTGG + Intergenic
1075484858 10:122813950-122813972 TGCCCACGGGAGGCCAGGGCTGG + Intergenic
1075544986 10:123348446-123348468 GGCCAGCCAGAGGCCCAGGCTGG - Intergenic
1075545634 10:123352325-123352347 GGCCAGAGGGAGGCCCAGGCAGG - Intergenic
1076321916 10:129589357-129589379 GGCCCAAGTGAGGCCCTGGCAGG - Intronic
1076599552 10:131647991-131648013 GGGAAATGGGAGGCGCTGGCGGG - Intergenic
1076805955 10:132858838-132858860 GGCCAGAAGGAGGCCCTGTCAGG + Intronic
1076816727 10:132918735-132918757 GGCCAAGAGCAAGCCCTGGCTGG - Intronic
1076849577 10:133086398-133086420 GGCCCAGAGGAGGCCCCGGCCGG - Intronic
1076851518 10:133095683-133095705 AGCCAAGACGAGGCCCTGGCTGG - Intronic
1076852433 10:133099662-133099684 GGCCAACAAGAGGACCTGCCCGG + Intronic
1076970039 11:127770-127792 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1077486971 11:2843434-2843456 GGCCCTGGGGAGGCCCTGCCTGG + Intronic
1077853612 11:6099800-6099822 GGCCAGGGGGAGGCACTGGTGGG - Intergenic
1077951455 11:6962305-6962327 AGCCAATGGGAGTCCCTGGCAGG - Intronic
1078861227 11:15249112-15249134 AGCCAATGGGAGGCACTGGAAGG - Intergenic
1080285707 11:30608675-30608697 GGCCAATGGGAGCCACTGGCTGG + Intergenic
1080612481 11:33916515-33916537 GGCCAAGGGAAGGCCATGACTGG - Intergenic
1081678118 11:44982847-44982869 AGCCAATGGAAGGCCCCGGCAGG + Intergenic
1081994571 11:47355184-47355206 GGCCAGCGGGGAGGCCTGGCGGG + Exonic
1082792852 11:57359280-57359302 GGTCAATGGGCGGCACTGGCAGG - Intronic
1083397552 11:62401924-62401946 GAGCAAGGGGAGGCCGTGGCAGG + Intergenic
1083578773 11:63811952-63811974 AGCCAATGGGAGGCAGTGGCAGG - Intergenic
1083811154 11:65107738-65107760 GGCCCACTGCAGGCCCTGCCCGG - Intronic
1083878822 11:65538384-65538406 GGCCCCCGGCAGGCACTGGCTGG + Intronic
1084488518 11:69464798-69464820 GACCACCGGGAGGCCCAGCCAGG + Intergenic
1085204826 11:74725235-74725257 GCCCTTTGGGAGGCCCTGGCGGG - Intronic
1085752582 11:79174613-79174635 AGCCAATGGGAGACTCTGGCAGG + Intronic
1086432589 11:86749624-86749646 GGTCAACAGGAGGCACTGGTGGG - Intergenic
1088058061 11:105609915-105609937 GGCAAAGGGCAGCCCCTGGCGGG - Intergenic
1088262873 11:107960884-107960906 AGCCAATGGGAGGCGCTGGCTGG - Intronic
1088604190 11:111512736-111512758 GGCCAGCGGGCGGCGCTGCCGGG - Intergenic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089411540 11:118247131-118247153 GGCCAACGGGAGGCATTGGCAGG - Intronic
1089570201 11:119402703-119402725 AGCCCACGGGAGCCCCAGGCAGG + Intergenic
1089593429 11:119559712-119559734 GGGCATGGGGAGGGCCTGGCTGG + Intergenic
1090228358 11:125084941-125084963 GGCCCACGGGGGGCACTGACAGG + Intronic
1090358707 11:126158097-126158119 GGCCAAAGGAGGGCTCTGGCCGG - Intergenic
1092196008 12:6550116-6550138 GGCCAAACGGAAGCCCTGGAGGG + Intronic
1094280330 12:28730362-28730384 GGCCAATGAGAGCCACTGGCAGG + Intergenic
1094607573 12:31962025-31962047 GGCCAACTTGAGGCCAGGGCTGG - Intronic
1096045465 12:48558387-48558409 GGCCAACGAGATGCCCTGAATGG - Intergenic
1096657717 12:53102107-53102129 TGCCATCTGGAGACCCTGGCAGG - Exonic
1096695334 12:53345045-53345067 GGGCAGCGGGGGGCGCTGGCTGG - Intronic
1097076256 12:56397134-56397156 GGCCCACGGGAAGCCATGGGTGG + Intergenic
1100774137 12:97955847-97955869 GGCCAATGGGAGGCACTGGTGGG - Intergenic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1101837983 12:108308452-108308474 GGCCAGCGAGAGGTCCGGGCGGG - Intronic
1101876918 12:108602216-108602238 GGCCAAGGTCAGGCCCTGGGAGG + Intergenic
1102196485 12:111029044-111029066 GGCTAGTGGGAGGCCCTGGTAGG - Intergenic
1102743985 12:115233503-115233525 GGGCAATGGGAGGCACTGGCAGG - Intergenic
1103493869 12:121345638-121345660 GGCCAATGGGAGGCACTGGCAGG - Intronic
1103576489 12:121881363-121881385 AGCCAACCTGAGACCCTGGCAGG + Intergenic
1103688661 12:122752851-122752873 GGCGCTCGGGCGGCCCTGGCCGG + Exonic
1103759406 12:123237208-123237230 GGACTACGGGAGGCCAAGGCAGG + Intronic
1104414798 12:128589289-128589311 GGGCAAGGGGAGGCCCTTGCAGG - Intronic
1104416315 12:128598999-128599021 AGCCAGCAGGAGGCCCTGGTGGG + Intronic
1104536727 12:129624654-129624676 AGCCCATGGGAGGCACTGGCAGG - Intronic
1104772411 12:131371769-131371791 GGCCAATGGGAGGCCTCAGCAGG - Intergenic
1104860474 12:131920909-131920931 GGCCAAGGGGAGACACTGCCTGG - Intronic
1104912385 12:132245557-132245579 GGACCACGGAGGGCCCTGGCTGG - Intronic
1104912407 12:132245617-132245639 GGACCACGGAGGGCCCTGGCTGG - Intronic
1105211916 13:18261955-18261977 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
1105931656 13:25058147-25058169 GGCCAGTGGGCAGCCCTGGCTGG - Intergenic
1107575138 13:41710831-41710853 TTCCAAAGAGAGGCCCTGGCAGG + Intronic
1109688144 13:65847520-65847542 GGCCAATGGGAGGCCTTGGTGGG + Intergenic
1113545472 13:111145703-111145725 AGCCAATAGGAGGCCCTGGCAGG - Intronic
1116707336 14:48318961-48318983 GGCCACAGGGAGACCCAGGCTGG + Intergenic
1116984260 14:51203296-51203318 GCCCCAAGGGAGGCCGTGGCAGG + Intergenic
1116991949 14:51286287-51286309 GGCCAATGGGAAGCACTAGCAGG + Intergenic
1117902812 14:60552687-60552709 GGACAACAGGAGGCCATGGGAGG + Intergenic
1119027426 14:71165251-71165273 GCCCAAGGGCAAGCCCTGGCAGG - Intergenic
1119310865 14:73645189-73645211 GGCGAAAGAGAAGCCCTGGCCGG + Intronic
1119650155 14:76377409-76377431 GCCCAAGGGGAGACCCGGGCAGG - Intronic
1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG + Intronic
1122052922 14:99072532-99072554 GGCACATCGGAGGCCCTGGCAGG - Intergenic
1122897812 14:104769085-104769107 GGGAGATGGGAGGCCCTGGCTGG - Intergenic
1122900195 14:104779247-104779269 GGCCAGCGGGGGACCTTGGCCGG - Intronic
1122933592 14:104945837-104945859 GCCCAACTGGAGGTCCAGGCTGG - Exonic
1122933708 14:104946332-104946354 GCCCAACTGGAGGTCCAGGCTGG - Exonic
1122933825 14:104946827-104946849 GCCCAACTGGAGGTCCAGGCTGG - Exonic
1122933940 14:104947322-104947344 GCCCAACTGGAGGTCCAGGCTGG - Exonic
1123033430 14:105461812-105461834 GGCCAAGGGGAGAGCTTGGCCGG + Intronic
1123110766 14:105865968-105865990 GGCCAGCGAGGAGCCCTGGCGGG - Intergenic
1124176091 15:27425356-27425378 GGCCACTGGGAGGCCGAGGCAGG + Intronic
1124226707 15:27901360-27901382 GGCCAATGGGAGACACTGGCAGG + Intronic
1125071305 15:35557127-35557149 AGCCAGCGGGACGCACTGGCAGG - Intergenic
1125491158 15:40149550-40149572 GGCCAGTGGGGGTCCCTGGCAGG + Intergenic
1125653293 15:41334792-41334814 GGACTTCGGGAGGCCGTGGCGGG - Intronic
1126117557 15:45222375-45222397 AGCCAATGGGAAGCACTGGCAGG - Intergenic
1127456391 15:59159449-59159471 GGCCAACAGGAGGCACTGGAAGG + Intronic
1128053827 15:64685025-64685047 GGCGAGCTGGAGGCCCGGGCTGG + Exonic
1129222098 15:74136882-74136904 TTCCAACGGGAGGCTCTGGGGGG - Intronic
1129596413 15:76967673-76967695 AGACAAAGGCAGGCCCTGGCTGG - Intergenic
1129725381 15:77899001-77899023 TGCCAAAGGGAGGTCCTTGCGGG - Intergenic
1129744374 15:78007914-78007936 GGCCAGCGGGAGGTGCTGGCAGG - Intronic
1130145343 15:81269664-81269686 GGCCAACAGGAAGTCCTGGGGGG + Intronic
1130676925 15:85961034-85961056 GGGCAGCGGGGGTCCCTGGCTGG + Intergenic
1131342881 15:91619336-91619358 GACCAATGGGAGGCTCTAGCAGG + Intergenic
1132252555 15:100344952-100344974 TGCCAAAAAGAGGCCCTGGCAGG - Intergenic
1132476753 16:143131-143153 TGCCAAGGGCAGGCCCAGGCTGG - Intergenic
1132557446 16:578845-578867 GGCCACCGTCAGGCCCAGGCAGG - Exonic
1132891197 16:2205657-2205679 GGCCAGCGGCAGGCCCTGATGGG - Intronic
1134125357 16:11612544-11612566 GGCCAGCGGGCGGCCAGGGCCGG + Intronic
1134164150 16:11916281-11916303 GGGCAGCGGCAGGCCCTGGTTGG + Intergenic
1135534666 16:23284024-23284046 GGCCAAAAAGAGGCACTGGCAGG - Intronic
1135881706 16:26263829-26263851 GGCCAATGGAAGGTACTGGCAGG - Intergenic
1135884259 16:26291125-26291147 AGAAAATGGGAGGCCCTGGCCGG + Intergenic
1136561597 16:31042340-31042362 GGCCACCGGGAGGCGCAGTCGGG - Intronic
1136561604 16:31042361-31042383 GGCCACCGGGAGGCGCTGCGGGG - Intronic
1137674397 16:50297117-50297139 GGGGAAAGGGAGGCCATGGCAGG + Intronic
1138311468 16:56027119-56027141 GGCCAATGGGAAGCCCCGGTGGG - Intergenic
1139111894 16:63902195-63902217 GGACAATAGGAAGCCCTGGCAGG - Intergenic
1140416022 16:74774524-74774546 GGCCAACGCGCGCCGCTGGCTGG - Exonic
1141513905 16:84530350-84530372 GGCCAGTGGGAGGCACTAGCAGG + Intronic
1142264086 16:89055591-89055613 GGGGAACTGGAGGCCCTGGCTGG - Intergenic
1142450638 16:90171362-90171384 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1142456924 17:62329-62351 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1142471825 17:168973-168995 GCCCCGGGGGAGGCCCTGGCTGG + Intronic
1142499705 17:325443-325465 GGGCATGTGGAGGCCCTGGCCGG - Intronic
1142863316 17:2776523-2776545 GGGCACCGGGAGGCGGTGGCAGG - Intergenic
1143364333 17:6396098-6396120 GGCCAGAGGCAGGCCTTGGCAGG - Intronic
1143537360 17:7549251-7549273 GGCCAGCAGGAGGCCGAGGCAGG - Exonic
1143634342 17:8155913-8155935 GGCCGGAGGGAGGCCCTGGTAGG - Intronic
1144726410 17:17504736-17504758 GGCCTCCGGGAGCCCCTGACTGG + Intergenic
1146371156 17:32266203-32266225 GGCCACCGCGGGGCCCGGGCTGG - Exonic
1146410694 17:32581589-32581611 AGCCAAAGTGAGGCCCTGTCGGG - Intronic
1147219589 17:38920518-38920540 GGCCAATGGCAGGGCCTGGTTGG - Exonic
1147247736 17:39133152-39133174 GGAGAATGGGTGGCCCTGGCTGG - Intronic
1147947196 17:44086800-44086822 GCCCCACTGGAGGCCCTGACAGG - Intronic
1148673750 17:49432899-49432921 AGCCAATGGGAGGCCCTGGCAGG + Intronic
1149008110 17:51826705-51826727 GGCCAATGAGGGGCCCTGGCAGG + Intronic
1149019842 17:51950417-51950439 GGCCAATAGGAGGCACTCGCAGG + Intronic
1149336787 17:55643834-55643856 GGCCAATGGGAAGCCCTGGAAGG - Intergenic
1149404952 17:56338971-56338993 ACCCAATGGGAGGCACTGGCTGG - Intronic
1149660333 17:58331420-58331442 GGCCCTCGGGGGGCCCTGGCAGG - Intergenic
1150139720 17:62717555-62717577 GGCCCATGGGAGGCCCCGGCAGG + Intronic
1150431688 17:65123271-65123293 GGCTCACGGGAGGCCTTGCCGGG - Intergenic
1151482734 17:74379919-74379941 GGCCAGCAGGAGGGGCTGGCAGG - Intergenic
1151540032 17:74760117-74760139 GGCCCGGGGGAGGGCCTGGCTGG + Intronic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151786097 17:76275772-76275794 GGCCAGCGGGGAGGCCTGGCAGG + Intronic
1152282283 17:79391990-79392012 GACCATCGCGGGGCCCTGGCGGG - Intronic
1152735202 17:81993882-81993904 GGCAAAGGGGAGGCCAGGGCCGG - Intronic
1152984827 18:311978-312000 GGACAATGAGAGGCACTGGCAGG - Intergenic
1153095126 18:1392271-1392293 GGCCAATGGGAGGCACTGGCAGG - Intergenic
1155062511 18:22241441-22241463 GGCCAAAGAGAGTGCCTGGCAGG - Intergenic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1157157729 18:45284341-45284363 GGCCAATGGGAGGCACTGTTGGG + Intronic
1158648788 18:59269012-59269034 GGCCATCGGGAAGCCGTGGCAGG - Exonic
1160011394 18:75109290-75109312 GGCCCATGGGAGGAGCTGGCTGG - Intergenic
1160239142 18:77110591-77110613 GGCCACCTGGCTGCCCTGGCAGG + Intronic
1160375693 18:78410089-78410111 GCCCAAAGGGAGAACCTGGCAGG + Intergenic
1160646837 19:197688-197710 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1160734749 19:657433-657455 GGCCAAGAGGAGGCCAGGGCTGG - Intronic
1160763494 19:797301-797323 GGCCAGTGGGAGGTGCTGGCGGG + Exonic
1160857973 19:1225942-1225964 GGGCAGCTGGGGGCCCTGGCAGG + Intronic
1160955218 19:1688187-1688209 GGCCAAGGTGGGGCCCAGGCAGG + Intergenic
1161024965 19:2032530-2032552 GGTCAGCGGGGGGGCCTGGCAGG + Intronic
1161404416 19:4083655-4083677 TTCAAACAGGAGGCCCTGGCTGG + Intergenic
1161588693 19:5118918-5118940 GGCGCAGAGGAGGCCCTGGCAGG + Intronic
1162514107 19:11138055-11138077 GGAAAACGGGAGGGCCTGGGAGG + Intronic
1162824612 19:13243987-13244009 GGGCCATGGGAGGCTCTGGCAGG + Intronic
1163234674 19:16023547-16023569 GGCCAGGGGGAGGCCTGGGCAGG - Intergenic
1163324851 19:16596794-16596816 GGGCAAAGTGAGGCCCTGGACGG + Intronic
1163535860 19:17876055-17876077 GGCCAGCGTGAGCACCTGGCGGG - Exonic
1164596599 19:29534285-29534307 GGCCAAAGGGAGGCCCAGACAGG - Intronic
1164941153 19:32253028-32253050 GGCCCTCAGGAGGCCTTGGCGGG - Intergenic
1165941085 19:39415119-39415141 GGCGGATGGGAGGCCCTGGAAGG - Exonic
1165949765 19:39467674-39467696 GGCCAACTGGGGGCTCCGGCAGG + Intronic
1166365947 19:42278602-42278624 GGCCAAAGAGAGGCCAAGGCTGG - Intronic
1166386917 19:42387508-42387530 AGCCGTCGGGAGGCCCCGGCTGG - Intronic
1167189422 19:47974162-47974184 GACCAATGGGATGCACTGGCAGG + Intronic
1167433035 19:49464186-49464208 GGCCAACGGGACGCCCCGCGGGG + Exonic
925284888 2:2709423-2709445 GGCCAACAGGGAGCCCTGGAAGG + Intergenic
925419832 2:3703347-3703369 GGGCAACGGGGAGCCCGGGCAGG - Intergenic
927477609 2:23425913-23425935 GGCCACCCTGAGGCCCTGGGCGG - Intronic
928341083 2:30443759-30443781 AGCCAATGGGAGGCCCTGGCTGG - Intergenic
929578692 2:43068453-43068475 GGCCCACGGGCGGCCCCCGCCGG - Intergenic
930747573 2:54900689-54900711 GGCCAACGGGGAGCACTGGTGGG - Intronic
932274622 2:70442817-70442839 AGCCAGTGGGAGGCACTGGCAGG - Intergenic
932893131 2:75613067-75613089 GGCCAATGGGAGGTGCTGGTGGG - Intergenic
933589345 2:84214645-84214667 GGCCAGTGGGAGGTGCTGGCTGG - Intergenic
934179852 2:89611002-89611024 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934290148 2:91685263-91685285 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934301711 2:91780518-91780540 GCCCACGGGGAAGCCCTGGCGGG - Intergenic
934655602 2:96115504-96115526 GGCCAAGGGGGGGCCTGGGCAGG - Exonic
934764602 2:96873719-96873741 AGCCAGAGGGAGGCCCTGGGTGG + Intergenic
934843283 2:97645307-97645329 GGGCAACGGGAAGCCATGGACGG + Intergenic
934895554 2:98116750-98116772 GGCAGATGGGAGGCCCAGGCAGG - Intronic
935263385 2:101374263-101374285 GTCCAACGGGAGGCTGAGGCAGG + Intronic
935336661 2:102022975-102022997 AGCCAACGTGATGCCCTGGGTGG - Intronic
935371397 2:102350689-102350711 GGCCAATGGGAGGCACTGGCAGG + Intronic
936675482 2:114709153-114709175 GACCAAAGGGAGGCATTGGCAGG + Intronic
936814095 2:116438192-116438214 AGCCAATGGGAGACACTGGCAGG - Intergenic
937154303 2:119707849-119707871 GGCCAACGGGGAGCACTAGCAGG + Intergenic
937158139 2:119735816-119735838 GGCCGCTGGGAGGCCTTGGCGGG - Intergenic
937671973 2:124547674-124547696 GGCCAAAGAGAGCCCCTTGCAGG + Intronic
938368797 2:130756161-130756183 GGCCAGCGGGAGGGGCGGGCCGG - Intronic
939005647 2:136783662-136783684 TTCCAACTGGAGGGCCTGGCAGG - Intronic
942004042 2:171679799-171679821 GGCCAACGGGAAGCCCCAGGAGG + Intergenic
944295160 2:198053322-198053344 AGCCAATGAGAGGCACTGGCAGG + Intronic
944309607 2:198218734-198218756 GGCCAATGTGAGGCACTTGCAGG - Intronic
944461662 2:199955997-199956019 GGCCACCGGGAGCCCTGGGCAGG - Exonic
948087726 2:235265531-235265553 GGCCAGCTGGAGGCCCTGGCAGG + Intergenic
948453510 2:238093216-238093238 GGCCCCCAGGAGGCCATGGCAGG - Intronic
1169488731 20:6054094-6054116 GGCCAGGGGCAGGCCCTAGCGGG - Intergenic
1169923224 20:10757109-10757131 TGCCAACTGGAAGCACTGGCAGG - Intergenic
1170598837 20:17825395-17825417 GGCCAATGGGGGGCCCGGGCAGG - Intergenic
1171134751 20:22686271-22686293 AGCCAATGGGAGGCACTGGCCGG + Intergenic
1171390558 20:24799078-24799100 CGCAAAAGGCAGGCCCTGGCTGG + Intergenic
1172814075 20:37672534-37672556 GGCCAATGGGAGGCGCCGGTGGG + Intergenic
1172958804 20:38782403-38782425 GGCCAATAGGGAGCCCTGGCAGG - Intergenic
1173183034 20:40818954-40818976 GGCCAATGGGAGGTATTGGCAGG - Intergenic
1173278072 20:41601981-41602003 GGCCAGAGGGAGGCCCTGTGTGG - Intronic
1173300783 20:41800661-41800683 GGCTCACGGGAGGCCCAGCCAGG - Intergenic
1174383513 20:50172483-50172505 GGCCAACGGGAGGCCCCGGTCGG + Intergenic
1175287994 20:57850732-57850754 GGATAACGGGAGCCCCTGACTGG - Intergenic
1175429762 20:58892422-58892444 CGCCAAAGGGAGGCTTTGGCGGG + Intronic
1176207159 20:63895355-63895377 GGCCCACGTCAGGCCCGGGCAGG + Intronic
1178006954 21:28233012-28233034 GGCCGACTGGAGGGCTTGGCTGG - Intergenic
1179721735 21:43320258-43320280 GGCCATGGGGAGGCCAAGGCTGG + Intergenic
1180187354 21:46146145-46146167 GCCCAAAGGGAGGCGCTGGGAGG + Intronic
1180814721 22:18782201-18782223 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
1181200908 22:21216537-21216559 GCCCACAGGGAAGCCCTGGCGGG + Exonic
1181700835 22:24620436-24620458 GCCCACGGGGAAGCCCTGGCGGG - Exonic
1181850937 22:25749533-25749555 GGCCAATGGAAGGCTCTGGGAGG - Intronic
1182787634 22:32920809-32920831 GGCCAAAGTGAGGCCCCAGCAGG + Intronic
1183208251 22:36433809-36433831 GGCCAGCGGGAGGGGCGGGCTGG + Intergenic
1183347257 22:37314744-37314766 GGCCCAGGGGAGCCCCTGGAGGG + Exonic
1183668184 22:39257015-39257037 GGCCAGAGGGAGGGCCTGGAAGG + Intergenic
1184689130 22:46109546-46109568 GGCCAACGGGGGGAGCTTGCTGG - Intronic
1184778184 22:46633607-46633629 TGCCAACGGGAGTCCCCAGCTGG + Intronic
1185118643 22:48952511-48952533 GGCCATCGGGAGCGGCTGGCAGG - Intergenic
1203226009 22_KI270731v1_random:78898-78920 GCCCACGGGGAAGCCCTGGCGGG - Intergenic
1203264818 22_KI270734v1_random:7888-7910 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
950189244 3:10965294-10965316 AGCTGATGGGAGGCCCTGGCAGG + Intergenic
950359754 3:12441808-12441830 GGCCAATGGGAGACTTTGGCAGG - Intergenic
950544696 3:13631435-13631457 GGCCAACGGGAGGTCCTGCAAGG + Exonic
950720221 3:14877247-14877269 GGCCAACGGGGAGGCCTGGCAGG - Intronic
950897954 3:16470396-16470418 GCCCAAGGGCAGGCCCTGGTTGG + Intronic
952234188 3:31462191-31462213 TACCAATGGGAGGCTCTGGCAGG + Intergenic
953559186 3:43971646-43971668 GGCCAATGGTGGGGCCTGGCTGG + Intergenic
953614680 3:44478905-44478927 GGCCAATGGGAAGCCCTGGCAGG - Intergenic
954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG + Intronic
956452270 3:69386288-69386310 GGGGCACGGGAAGCCCTGGCCGG + Intronic
960708477 3:120504458-120504480 GGCCAGTGGGAGGGGCTGGCAGG + Intergenic
961311620 3:126005617-126005639 GGCCAATGGGAGACACTGGCAGG + Intergenic
961714665 3:128850101-128850123 GCCCCCCGGGAGGCCATGGCCGG - Intergenic
962613701 3:137103532-137103554 GGGCAATGGGAGCCCCTGGAGGG + Intergenic
963025036 3:140911100-140911122 TTCCAACAGGAGGCACTGGCAGG - Intergenic
964605170 3:158553145-158553167 GGCCAACGGGAGGGACTGTCAGG + Intergenic
968134986 3:196214806-196214828 AGCCAGCGGGAGGCCCTGCCTGG - Intronic
968370844 3:198221834-198221856 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
968645374 4:1737946-1737968 GGCCAACGCCATGCCCAGGCCGG - Intronic
968657935 4:1786675-1786697 TGCCAAGGTGAGGGCCTGGCTGG - Intergenic
968994799 4:3938663-3938685 GGCCAGCGGGAGGCTCAGGGAGG + Intergenic
969285741 4:6200756-6200778 GGCCAGCGGGCGGCCGGGGCAGG + Intergenic
969829428 4:9782620-9782642 GGCCAACTGGACGCCCTGGGAGG + Exonic
970145902 4:13035459-13035481 GGCCAATGGGAGGCCCTTTCAGG - Intergenic
970693298 4:18644660-18644682 AGCCAATGGGAGGCACTGTCAGG - Intergenic
970956622 4:21819164-21819186 GTGCAACAGGAAGCCCTGGCAGG - Intronic
972385644 4:38563032-38563054 GGCTAATGGGAGGCTCTGGTGGG - Intergenic
973176459 4:47212245-47212267 GGCCAATGGGAGACCCAGGCAGG - Intronic
973894165 4:55395882-55395904 GGCCAATGGGAGGCCGTCGCGGG + Intergenic
976080086 4:81345946-81345968 GTCCCAAGGGAGGCCCTGGTGGG + Intergenic
976097051 4:81519261-81519283 GGTCATTGGGAGGCACTGGCAGG - Intronic
976287848 4:83387186-83387208 GGCCAGTGGGAGGCACTGGCGGG - Intergenic
976334556 4:83870522-83870544 GGCCAATGGGAGGTGCTGGTAGG + Intergenic
976599895 4:86928422-86928444 GGCCAATGGAAGGCACTGGGAGG - Intronic
977287816 4:95130974-95130996 GCACATCGGGAGGCCATGGCGGG - Intronic
977400118 4:96521411-96521433 GGCCCACGGGAGCCCACGGCGGG - Intergenic
977586848 4:98783730-98783752 GGGCAATGGGAGACCCTGTCAGG - Intergenic
978888614 4:113796157-113796179 GGACATCGGGAGGCCGAGGCGGG - Intergenic
979258780 4:118630754-118630776 GGCCGACGGGAGGCAGAGGCTGG - Intergenic
979328835 4:119406239-119406261 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
979329569 4:119409802-119409824 GGCCGACGGGAGGCAGAGGCTGG + Intergenic
985128047 4:186714634-186714656 TCCAAACGGGAGGCCCTGACAGG + Intronic
985517640 5:355131-355153 GGGCACCAGGAGGCCCAGGCTGG - Intronic
985626572 5:991958-991980 AGCCAAGAGGATGCCCTGGCAGG + Intergenic
985760754 5:1747345-1747367 GGCCACCCTGAGGCCCTGTCAGG - Intergenic
988510917 5:31864077-31864099 AGCCAATGGGAGGCACTGGCAGG + Intronic
988670036 5:33371439-33371461 AGCCAATGGGAGGCACTGGATGG + Intergenic
991042264 5:62188254-62188276 GGCCAATGGGAGGCCAAGGCAGG - Intergenic
992489852 5:77231919-77231941 GACCAGTGGGAGGCACTGGCAGG - Intronic
992662121 5:78972119-78972141 AGCCAATGGGGAGCCCTGGCAGG + Intronic
995881864 5:116852240-116852262 AGCCAACGGGAGGCTGAGGCAGG + Intergenic
997335609 5:133107087-133107109 GGCCCTGGGTAGGCCCTGGCAGG - Intergenic
998007399 5:138666078-138666100 GGCCAATGGAAGCCACTGGCAGG - Intronic
999147683 5:149406781-149406803 GGCCAATGGGGGGCCCTGGGAGG + Intergenic
999177033 5:149638946-149638968 GGCCAATGGGAGGCACTGGCAGG + Intergenic
999340155 5:150763245-150763267 GGCAACAGGGAGGCCCTGGTTGG + Intergenic
1001183847 5:169547892-169547914 TGCCGACTGGAGGCACTGGCAGG - Intergenic
1001530234 5:172456070-172456092 GGCCAGTGGAAGGGCCTGGCAGG + Intergenic
1001592235 5:172873447-172873469 TGTCACCTGGAGGCCCTGGCTGG - Intronic
1002314520 5:178334410-178334432 GGCCACCGGGCGGCACCGGCCGG + Intronic
1002730078 5:181327390-181327412 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1004578374 6:16922510-16922532 GGCCAATGGGAGGCAGTGGCAGG + Intergenic
1004611347 6:17243194-17243216 GGCTCACGGGAGGCCGAGGCAGG - Intergenic
1005166584 6:22929005-22929027 GGTCAATGGTAGGCTCTGGCAGG - Intergenic
1005498820 6:26412404-26412426 GGCCAATGGGAGGCCCTGATAGG - Intronic
1006447189 6:34086238-34086260 GGGCAGCAGGAGGCCCAGGCTGG - Intronic
1006878923 6:37322206-37322228 TGGCAACAGGAGGCCCTGACAGG - Intronic
1006927462 6:37665091-37665113 GACCAAAGCTAGGCCCTGGCTGG + Intronic
1007085294 6:39140116-39140138 TGCCAGTGGGAGGCACTGGCAGG + Intergenic
1007189792 6:40003716-40003738 GGCCAATGGGAGGCATGGGCAGG + Intergenic
1011055340 6:83197927-83197949 GGCAAGCTGGAGGACCTGGCGGG - Exonic
1014747212 6:125214175-125214197 GGCCAATGGGAAGCCCCTGCAGG - Intronic
1014946084 6:127499791-127499813 GGCCAATAGAAGGCACTGGCAGG + Intronic
1015525929 6:134175415-134175437 CGGGAACGGGAGGACCTGGCGGG - Intronic
1017039396 6:150295598-150295620 AGCCAGTGGGAGGCACTGGCAGG - Intergenic
1018093174 6:160362945-160362967 GGCCCAAAGGAGACCCTGGCAGG - Intronic
1019491910 7:1318198-1318220 GGTCAGGGGGAGGCCCGGGCAGG - Intergenic
1019554186 7:1620383-1620405 AGCCACCGGGAGGCCGAGGCAGG - Intergenic
1019558243 7:1643054-1643076 GGCCAGAGGGAGGCCCTCGGAGG - Intergenic
1019605833 7:1909743-1909765 GGGCAGCAGCAGGCCCTGGCTGG - Intronic
1020224448 7:6269089-6269111 GGCCACTGGGAGCCACTGGCAGG - Intronic
1020292010 7:6729685-6729707 GACCAACGGTGGGCCCTGGGAGG + Intergenic
1022473205 7:30694324-30694346 GGCAAAGGAGAGGCCCTGGCTGG + Intronic
1022597364 7:31725231-31725253 GGCCATCGGGAGGTACTGGTAGG + Intergenic
1022665958 7:32410645-32410667 AGCCAATGGGAGGCACTGGTAGG + Intergenic
1024074414 7:45811321-45811343 GGTCACCGGGAGGCCCAAGCTGG - Intergenic
1024074747 7:45812679-45812701 GGTCACCGGGAGGCCCAAGCTGG - Intergenic
1024075238 7:45814593-45814615 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1024649650 7:51392396-51392418 GGCCGACGGGAGGCAGAGGCTGG + Intergenic
1025052997 7:55744207-55744229 GGTCACCGGGAGGCCCAAGCTGG + Intergenic
1025176318 7:56804152-56804174 GGCCACCGGGAGGCCGGAGCTGG - Intergenic
1025178190 7:56812394-56812416 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178624 7:56814136-56814158 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179060 7:56815926-56815948 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179515 7:56817812-56817834 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179965 7:56819650-56819672 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180439 7:56821632-56821654 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180884 7:56823481-56823503 GGCCGCCGGGAGGCCCAAGCTGG + Exonic
1025181756 7:56827059-56827081 GGCCGCCGGGAGGCCCAAGCTGG + Intronic
1025182629 7:56831279-56831301 GGCCGACGGGAGGCAGAGGCTGG + Intergenic
1025689297 7:63745695-63745717 GGCCGACGGGAGGCAGAGGCTGG - Intergenic
1025690159 7:63749936-63749958 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690606 7:63751759-63751781 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691056 7:63753582-63753604 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691491 7:63755358-63755380 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691931 7:63757181-63757203 GGCCGCCGGGAGGCCCAAGCTGG - Exonic
1025692379 7:63759004-63759026 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692823 7:63760827-63760849 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693240 7:63762506-63762528 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693683 7:63764329-63764351 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025694162 7:63766316-63766338 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1026843717 7:73685166-73685188 GGCCTACGGGAGGCTGAGGCAGG + Intronic
1028484976 7:91347856-91347878 GGCCAACAGGAAGCCCCTGCTGG - Intergenic
1029346219 7:99980667-99980689 GGCCAATGGGAGTACCAGGCCGG - Intergenic
1029558958 7:101289848-101289870 GGCCAATGGGAGTACCAGGCCGG + Intergenic
1031144086 7:117978720-117978742 GGCCAATGGGAGGCACTCGCAGG + Intergenic
1032051084 7:128651503-128651525 GGCCGACGGGAGGCAGAGGCTGG - Intergenic
1032051746 7:128654313-128654335 GGCCACCGGGAGGCCCAAGCTGG - Intergenic
1033342375 7:140502132-140502154 GGCCATGGGGAGCCCCTGGGTGG + Intergenic
1034779059 7:153860385-153860407 GGCCAGTGGGAGGCACTGGAAGG + Intergenic
1034860585 7:154591749-154591771 CGCCAGCTGCAGGCCCTGGCTGG + Intronic
1035765831 8:2104715-2104737 GGGCAGCGGGAGGCCCTCACCGG - Intronic
1036179065 8:6567649-6567671 AGCCAATGGGAGGCCCTTGAAGG + Intronic
1036604374 8:10292936-10292958 GGCCTACAGGAGCCCTTGGCTGG - Intronic
1036755277 8:11467163-11467185 GGCCCACGGTAGGCGCTCGCGGG - Intronic
1036760471 8:11505459-11505481 GGCCAACTGTAGCCTCTGGCCGG + Intronic
1036950245 8:13133307-13133329 GCCCAGCGGGAGGGCCCGGCTGG - Intronic
1037210334 8:16378308-16378330 GGCCAATGCGAAGCCCTTGCAGG - Intronic
1037906377 8:22718248-22718270 GGCCTAGGGGATGCACTGGCTGG - Intronic
1039171356 8:34749512-34749534 AGCCAACGGGAGGTGCTGGAGGG - Intergenic
1044607184 8:94057685-94057707 GGCCAATGGGCAGCACTGGCAGG - Intergenic
1045335997 8:101205241-101205263 GGCCACCTGCAGGGCCTGGCAGG + Exonic
1045376367 8:101578405-101578427 TGCCGATGGGAGGCACTGGCAGG - Intronic
1047451038 8:124965157-124965179 GGCCAATGAGAGGCACTGACAGG - Intergenic
1048226361 8:132590191-132590213 GGCCAATGGGAGGCAATGGAGGG + Intronic
1049129094 8:140820796-140820818 GTTCAAGGGGAGGTCCTGGCTGG + Intronic
1049203221 8:141351801-141351823 GACAAGCGGAAGGCCCTGGCTGG + Intergenic
1053522177 9:38791442-38791464 GGCCAAGGGGAGGCCCTCAAGGG - Intergenic
1054851860 9:69854708-69854730 GGCCCATGGGAGGCACTGGCAGG + Intronic
1055650586 9:78403215-78403237 TGCAAATGGGAGGCACTGGCAGG + Intergenic
1055734742 9:79314733-79314755 TGCCAACAGGAGGCCCTTGAGGG - Intergenic
1056170502 9:83980363-83980385 GCCCGAAGGGAGGCGCTGGCGGG - Intronic
1056591193 9:87967361-87967383 GGCCATGGGGAGGCCTTGGAGGG + Exonic
1058077626 9:100667209-100667231 GGCCAAGGGGAGGCCAAGGAGGG + Intergenic
1060509406 9:124221216-124221238 GGCCAAGGGGAAGCACTGGCAGG + Intergenic
1060752962 9:126186181-126186203 ACCCAATGGGAGGCACTGGCAGG - Intergenic
1061045696 9:128163757-128163779 GGCCAAGGGGAGGCCCAGGCAGG - Exonic
1062050244 9:134443372-134443394 GCCCAAAGGGAGGCCAAGGCAGG + Intergenic
1062296213 9:135828543-135828565 GGCCAAGGTGAGGCCCTAGATGG + Intronic
1062754493 9:138279904-138279926 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1203512491 Un_KI270741v1:134484-134506 CGCCCACTGGAAGCCCTGGCGGG - Intergenic
1203578397 Un_KI270745v1:24064-24086 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1185802306 X:3024095-3024117 GGCCACCTGGAGCCCCTGGACGG + Exonic
1186352562 X:8755203-8755225 GGCTAATGGGAGGCAGTGGCAGG + Intergenic
1186776056 X:12865696-12865718 GGCCAATAGGAGGCCGTGGTTGG - Intergenic
1187223823 X:17356332-17356354 AGCCAATGGGAGGCCCCAGCAGG - Intergenic
1187571806 X:20511637-20511659 GGCCAATGGGAAGCCCCAGCAGG + Intergenic
1188524680 X:31076011-31076033 AGTCAACGGGAGGCACTGGCAGG + Intergenic
1189536142 X:41937127-41937149 GGCCAACGGGAAGCCCCTGTAGG + Intergenic
1189807388 X:44749472-44749494 GGCCTTTGGGAGGCCCAGGCGGG - Intergenic
1196174783 X:112628508-112628530 GGCCAATGATAGGCACTGGCAGG + Intergenic
1196804744 X:119574397-119574419 GCCCCACGGGAGGCCCGGGGCGG - Intergenic
1199160293 X:144601653-144601675 GGCTAATGGGAGGCACTAGCAGG + Intergenic
1199504298 X:148544135-148544157 GGCAAATGGGTGGCCCTGGGAGG - Intronic
1199981312 X:152922037-152922059 GGCCAAGAGGTGGCCCAGGCTGG - Intronic
1200207648 X:154328900-154328922 GGCCAAGGGGAGGCTGGGGCAGG - Intronic
1201178005 Y:11321642-11321664 AGCCAAAGGGAGGCCCTGCGAGG + Intergenic