ID: 1101818127

View in Genome Browser
Species Human (GRCh38)
Location 12:108161664-108161686
Sequence GTGGTACTCTGTTGGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101818122_1101818127 18 Left 1101818122 12:108161623-108161645 CCAGGAGAGAATAAATTTCTGCT 0: 1
1: 2
2: 29
3: 195
4: 578
Right 1101818127 12:108161664-108161686 GTGGTACTCTGTTGGCAGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 317
1101818121_1101818127 24 Left 1101818121 12:108161617-108161639 CCAGAACCAGGAGAGAATAAATT 0: 2
1: 16
2: 177
3: 888
4: 3162
Right 1101818127 12:108161664-108161686 GTGGTACTCTGTTGGCAGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101818127 Original CRISPR GTGGTACTCTGTTGGCAGCC CGG Intronic
900041190 1:465883-465905 GTGGTATTCAGCTGGCAGCTGGG - Intergenic
900062621 1:700859-700881 GTGGTATTCAGCTGGCAGCTGGG - Intergenic
901815710 1:11792243-11792265 CTGGTACTCTGTGGGAACCCTGG + Intronic
902450410 1:16493219-16493241 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
902469466 1:16638472-16638494 GTGGCAGCCTGTGGGCAGCCAGG - Intergenic
903776953 1:25799773-25799795 GTCCTCCTCTGCTGGCAGCCGGG - Intergenic
905358053 1:37398701-37398723 GTGTTGCTCTGTCGCCAGCCTGG + Intergenic
908173459 1:61530534-61530556 GTGGTTCTCAGTACGCAGCCTGG - Intergenic
911409003 1:97478315-97478337 GTCTTACTCTGTTGCCAGGCTGG + Intronic
913535087 1:119764349-119764371 ATGGGACTCTGTGGGCAGGCTGG - Exonic
915154793 1:153866172-153866194 GTGTCACTCTGTTGCCAGGCTGG - Intronic
916095704 1:161347834-161347856 GTGTCACTCTGTTGCCAGGCTGG - Intronic
916190826 1:162176536-162176558 GTGTTGCTCTGTTGCCAGGCTGG + Intronic
918016385 1:180637020-180637042 GTCTTACTCTGTTGCCAGGCTGG - Intronic
920838700 1:209535742-209535764 ATGGTGCACTGGTGGCAGCCTGG + Intergenic
922864536 1:228848350-228848372 GGGGTACTCAGCAGGCAGCCTGG - Intergenic
923031817 1:230255234-230255256 GTGGCAGTGTGGTGGCAGCCTGG + Exonic
923564857 1:235068999-235069021 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
924830634 1:247590847-247590869 GTGTTACTCTGTTGCCAGGCTGG - Intergenic
1063432188 10:6000180-6000202 GTGCTCCTCTGTTGGGGGCCAGG - Intergenic
1063650382 10:7930167-7930189 GTGCTACTCTGTTGCCAGGTTGG - Intronic
1063872000 10:10427548-10427570 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1064711376 10:18129712-18129734 GTGTCACTCTGTTGACAGGCTGG - Intergenic
1066075924 10:31876478-31876500 GTCTTGCTCTGTTGTCAGCCTGG - Intronic
1067424404 10:46194117-46194139 CTGGTGCTCTTTGGGCAGCCTGG + Intergenic
1067727756 10:48784569-48784591 GTCTCACTCTGTTGGCAGGCTGG + Intronic
1068102696 10:52575743-52575765 GTGGTGCTCTGTCTGAAGCCAGG + Intergenic
1069523104 10:69141911-69141933 GTCTTGCTCTGTTGCCAGCCTGG + Intronic
1070187878 10:74083895-74083917 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1073997146 10:109328571-109328593 GTCTCACTCTGTTGGCAGGCTGG + Intergenic
1075087570 10:119423692-119423714 TTGGTGCTCTGCTGGCAGCATGG - Intronic
1076967461 11:102113-102135 GTGGTATTCAGCTGGCAGCTGGG - Intergenic
1077088776 11:768443-768465 GTCTTGCTCTGTTGGCAGGCTGG - Exonic
1077140073 11:1020391-1020413 GTGGCACTCTGAGTGCAGCCTGG + Intronic
1079897004 11:26132714-26132736 TTGCTATTCTGTTGGCAGCCAGG + Intergenic
1080846205 11:36029213-36029235 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1080945928 11:36975247-36975269 GTCTCACTCTGTTGCCAGCCTGG + Intergenic
1082919014 11:58471353-58471375 GTCTCACTCTGTTGGCAGGCTGG - Intergenic
1083835645 11:65265197-65265219 GTTGCACTCTGTTGCCAGGCTGG - Intronic
1084766029 11:71309041-71309063 GTCCTGCTCTGTTGCCAGCCTGG - Intergenic
1085451052 11:76633674-76633696 GTCTTGCTCTGTTGCCAGCCTGG + Intergenic
1085745926 11:79114101-79114123 GTGGTACAGGGTTGGCAGCAAGG - Intronic
1089747191 11:120625695-120625717 CTGGCACTCTGTTTGGAGCCAGG - Intronic
1091512012 12:1137126-1137148 GTCTCACTCTGTTGGCAGGCTGG + Intronic
1093948639 12:25138431-25138453 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1094220251 12:27985388-27985410 TTGCTTCTCTGTTGGAAGCCCGG - Intergenic
1094475853 12:30840038-30840060 GTGAGACTCTGCTGGCAGTCAGG + Intergenic
1095345966 12:41148814-41148836 GTCGTACTCTGTTGCCAGGCTGG - Intergenic
1097027179 12:56065651-56065673 GTCGCACTCTGTTGCCAGGCTGG - Intergenic
1100643022 12:96500872-96500894 GTAATAGTCTGCTGGCAGCCTGG - Exonic
1100728822 12:97440991-97441013 GTGTCACTCTGTTGCCAGGCTGG - Intergenic
1101818127 12:108161664-108161686 GTGGTACTCTGTTGGCAGCCCGG + Intronic
1102542998 12:113635784-113635806 GTCTTACTCTGTTGGCCCCCAGG - Intergenic
1103293125 12:119863554-119863576 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1103492931 12:121337186-121337208 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1104347982 12:128020023-128020045 GTGGTTATCTGTTGTCAGCAGGG + Intergenic
1104559590 12:129831897-129831919 GTCTTGCTCTGTTGGCAGGCTGG + Intronic
1105399746 13:20079286-20079308 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1105767722 13:23578415-23578437 GTGCTACGCCGTTGGAAGCCTGG + Intronic
1107129197 13:36877330-36877352 GTCTTGCTCTGTTGGCAGGCCGG - Intronic
1107605664 13:42053646-42053668 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1108391317 13:49950715-49950737 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1109488121 13:63055655-63055677 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
1109973319 13:69799057-69799079 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1112220593 13:97486051-97486073 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1115775515 14:36710458-36710480 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1117247856 14:53903694-53903716 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1117263111 14:54057226-54057248 TTGGTTCTTTGTTGACAGCCAGG - Intergenic
1118277801 14:64401190-64401212 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1118860853 14:69661827-69661849 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1118924543 14:70180085-70180107 GTGGTTCTCTCTTGGCAACAGGG - Intronic
1119284872 14:73444825-73444847 GTGTCACTCTGTTGCCAGGCTGG - Intronic
1120528628 14:85606552-85606574 GTGCTGCTCTGTTGCCAGACTGG + Intronic
1121071166 14:91023053-91023075 GTTTTACTCTGTTGCCAGGCTGG - Intronic
1122509905 14:102257945-102257967 GTCTCACTCTGTTGGCAGGCTGG - Intronic
1122616629 14:103022389-103022411 GTTTCACTCTGTCGGCAGCCTGG + Intronic
1122676134 14:103415120-103415142 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1122759685 14:104013773-104013795 GTGGTAACCTCTTGGGAGCCAGG + Intronic
1122961716 14:105096887-105096909 GAGATGCTCTCTTGGCAGCCAGG - Intergenic
1123144449 14:106115313-106115335 GTCTTGCTCTGTTGCCAGCCTGG - Intergenic
1123714786 15:23019765-23019787 GTGTCACTCTGTTGCCAGGCTGG - Intronic
1124020515 15:25918078-25918100 GTCTCACTCTGTTGCCAGCCTGG - Intergenic
1124466892 15:29948230-29948252 GTGTTGCTCTGTTGCCAGGCTGG - Intronic
1126600948 15:50426982-50427004 GTCTTGCTCTGTTGTCAGCCTGG + Intronic
1128088245 15:64900596-64900618 GTCTTGCTCTGTTGGCAGGCTGG - Intronic
1128095862 15:64955081-64955103 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1128571613 15:68737655-68737677 GTCATACTCTGTTGCCAGGCTGG - Intergenic
1129317748 15:74755844-74755866 GTCTTACTCTGTTGCCAGGCTGG + Exonic
1130144032 15:81258668-81258690 GTGGTGCTCTGTTGTCTGGCTGG - Intronic
1131260804 15:90886706-90886728 GTGGTAGCCTGGTGGCAGGCAGG - Intronic
1132427358 15:101729719-101729741 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1132440710 15:101861714-101861736 GTGGTATTCAGCTGGCAGCTGGG + Intergenic
1133128006 16:3658641-3658663 GTGTTGCTCTGTTGCCAGGCTGG - Exonic
1133433281 16:5757259-5757281 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
1133831194 16:9325203-9325225 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1134477864 16:14591359-14591381 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1135396695 16:22137041-22137063 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1135685605 16:24496133-24496155 GTTTTACTCTGTTGCCAGGCTGG - Intergenic
1135873923 16:26179308-26179330 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1136588964 16:31205671-31205693 GTGTTGCTCTGTTGCCAGGCTGG + Intergenic
1137523741 16:49215706-49215728 GTCTTGCTCTGTTGCCAGCCTGG + Intergenic
1138067646 16:53958746-53958768 GTTGTGCTCTGTTGGCTGCAAGG - Intronic
1138308058 16:55996649-55996671 TTGGGACTTTGTAGGCAGCCGGG - Intergenic
1139609719 16:68047083-68047105 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1139876055 16:70146836-70146858 GTCTTGCTCTGTTGCCAGCCTGG - Intronic
1140359735 16:74334262-74334284 GTCTTGCTCTGTTGCCAGCCTGG + Intergenic
1142111692 16:88335378-88335400 GGGGTGCTCTGTGGGCAGCTGGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144666290 17:17104603-17104625 CAGGTACTCTGCTAGCAGCCAGG - Intronic
1146035383 17:29401682-29401704 GTTTTACTCTGTTGGGAGGCTGG + Intronic
1146077897 17:29749754-29749776 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1146238157 17:31187226-31187248 GTGTTGCTCTGTTGCCAGGCTGG + Intronic
1146307098 17:31738728-31738750 ATGCCACTCTGTTGGCAGCTGGG - Intergenic
1147584593 17:41646781-41646803 GTCTTACTCTGTTGCCAGCCTGG - Intergenic
1147606194 17:41775075-41775097 GTCTTGCTCTGTTGTCAGCCAGG - Intronic
1148099000 17:45075738-45075760 GTCTTGCTCTGTTGCCAGCCTGG - Intronic
1149008462 17:51830165-51830187 GTCTTGCTCTGTTGCCAGCCTGG - Intronic
1149243431 17:54677977-54677999 GTGTTACTCTGCTGTCACCCAGG + Intergenic
1149700164 17:58648594-58648616 GTGTCACTCTGGTGGCAGCTTGG + Intronic
1150766942 17:68009939-68009961 GTGTTGCTCTGTTGCCAGGCTGG + Intergenic
1151093232 17:71466441-71466463 GTGTTGCTCTGTTGCCAGGCTGG + Intergenic
1151204291 17:72494359-72494381 GTGGTATTCTGAGGGCAGTCAGG - Intergenic
1151958525 17:77392816-77392838 GTGGCTCTCTGTGGGGAGCCTGG + Intronic
1152188837 17:78875868-78875890 GTGGGACTCTGATGCCAGCCTGG - Intronic
1152316991 17:79586814-79586836 GTTTTCCTCTGATGGCAGCCAGG + Intergenic
1153122198 18:1742584-1742606 GTCTTGCTCTGTTGGCAGGCTGG + Intergenic
1153206965 18:2713653-2713675 GTGTCACTCTGTTGCCAGGCTGG - Intronic
1153218570 18:2843020-2843042 GTCTTACTATGTTGTCAGCCTGG - Intergenic
1153558579 18:6345365-6345387 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1153799074 18:8652593-8652615 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1154272936 18:12935529-12935551 GTCTTACTCTGTTGTCAGGCTGG - Intergenic
1156271720 18:35541053-35541075 ATGGTACTCTGCAGGCAGGCTGG - Intergenic
1156960729 18:43026522-43026544 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1158191300 18:54831803-54831825 GTCTTGCTCTGTTGGCAGGCTGG + Intronic
1159617242 18:70595559-70595581 GTGGTACTCAGTTGGCACAGAGG - Intergenic
1159949382 18:74470151-74470173 TTGGGACTCTGTTGGTAGGCAGG + Intergenic
1160644265 19:171736-171758 GTGGTATTCAGCTGGCAGCTGGG - Intergenic
1161246264 19:3254034-3254056 TCTGCACTCTGTTGGCAGCCAGG + Intronic
1161814819 19:6493699-6493721 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
1162232123 19:9275936-9275958 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1162355077 19:10178225-10178247 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1162488215 19:10975339-10975361 GTGTTTCTCTGTTGCCAGGCTGG + Intronic
1163179608 19:15589642-15589664 GTTTCACTCTGTTGCCAGCCTGG - Intergenic
1163260596 19:16187433-16187455 GTCTCACTCTGTTGCCAGCCTGG - Intronic
1163384350 19:16990222-16990244 GTCTTGCTCTGTTGCCAGCCTGG - Intronic
1164035484 19:21450383-21450405 GTGTCACTCTGTTGCCAGGCTGG - Intronic
1165620268 19:37240127-37240149 GTGTCACTCTGTTGCCAGGCTGG - Intronic
1167585626 19:50373733-50373755 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1167817061 19:51892344-51892366 GTCTTGCTCTGTTGGCAGACTGG - Intronic
1167864607 19:52314443-52314465 GTTTCACTCTGTTGGCAGGCTGG - Intronic
1168166021 19:54548625-54548647 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
927152070 2:20201959-20201981 CTGGTGGTCTGTTGGCAGGCTGG - Exonic
928541310 2:32286573-32286595 GTTGCGCTCTGTTGGCAGGCTGG + Intronic
930349501 2:50232414-50232436 GTGTCACTCTGTTGCCAGGCTGG + Intronic
931142135 2:59472560-59472582 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
933360334 2:81274644-81274666 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
934669526 2:96201556-96201578 GTCTTACTCTGTTGCCAGGCTGG - Intronic
936147372 2:109989406-109989428 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
936197320 2:110382035-110382057 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
936972440 2:118188108-118188130 GTGGTACACTGGGGGCAGCGTGG + Intergenic
937182275 2:120007495-120007517 GTGTTGCTCTGTTGCCAGGCTGG + Intergenic
937770124 2:125710862-125710884 GTGGTTATCTGTTGTCAGCACGG - Intergenic
937990053 2:127657193-127657215 GTGGCTCTCTGTTAGCACCCAGG + Intronic
938020048 2:127898847-127898869 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
938366613 2:130739332-130739354 GTTGTACTCTATTGCCAGACTGG + Intergenic
939408893 2:141798675-141798697 GTCTTACTCTGTTGCCAGGCTGG - Intronic
939488388 2:142846497-142846519 GTTTTACTCTGTTGCCAGGCTGG + Intergenic
940314370 2:152311818-152311840 GTGTTGCTCTGTTGCCAGGCTGG - Intergenic
941275128 2:163481303-163481325 GTCTTACTCTGTTGTCAGGCTGG - Intergenic
941302709 2:163824097-163824119 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
941964889 2:171291259-171291281 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
944103355 2:196053291-196053313 GTGGCTCTCTATTGCCAGCCTGG - Intronic
944759545 2:202799905-202799927 GTGTCACTCTGTTGCCAGGCTGG + Intronic
945977206 2:216280237-216280259 GTGGGGATCTGGTGGCAGCCTGG - Intronic
946258332 2:218463883-218463905 GTCTTGCTCTGTTGGCAGGCTGG + Intronic
947152487 2:227129710-227129732 CTGGTACACTTTTTGCAGCCAGG + Intronic
947227133 2:227851355-227851377 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
948472389 2:238192175-238192197 GTCTCACTCTGTTGGCAGGCTGG - Intronic
1169150222 20:3283564-3283586 GTGGGACTCTCCTGGCATCCAGG - Intronic
1171998197 20:31749965-31749987 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1172072423 20:32268076-32268098 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1172278867 20:33696476-33696498 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1172283428 20:33724075-33724097 GTCTTGCTCTGTTGGCAGGCTGG - Intergenic
1174700843 20:52606978-52607000 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1174912514 20:54622161-54622183 GTGCTGCTCTGTTGCCAGGCTGG - Intronic
1174982392 20:55410792-55410814 GTGTCACTCTGTTGCCAGGCTGG - Intergenic
1175374631 20:58515574-58515596 CTGGGACTCTGGTGGCACCCTGG + Intergenic
1177280844 21:18981049-18981071 GTCTTACTCTGTTGCCAGACTGG - Intergenic
1178848277 21:36191754-36191776 GTCTTACTCTGTTGCCAGGCTGG - Intronic
1179482654 21:41688240-41688262 GTGGTACCCGGGTGGCCGCCAGG + Intergenic
1179773416 21:43642330-43642352 GTGTTGCTCTGTTGCCAGGCTGG - Intronic
1180097453 21:45564099-45564121 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1180594101 22:16962470-16962492 GTGGAAATCTGTTGGGAGCCCGG + Exonic
1180628685 22:17211896-17211918 GTCTCACTCTGTTGGCAGGCTGG - Intronic
1181012288 22:20048674-20048696 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1182715600 22:32354296-32354318 GTGCTACACTGTTGGCAGCAGGG - Intergenic
1183631976 22:39039056-39039078 GTGGTCATCTGTTGTCAGCAGGG + Intergenic
1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG + Intronic
950395095 3:12728044-12728066 GCTGTACTCTGTTTGCAGCAAGG - Intergenic
951339646 3:21468897-21468919 GTCTTACTCTGTTGCCAGACTGG - Intronic
951476375 3:23110761-23110783 GTCTTGCTCTGTTGGCAGGCTGG - Intergenic
951775597 3:26307143-26307165 GTGGTTATCTGTTGTCAGCAGGG + Intergenic
953619748 3:44522885-44522907 GTGGTCATCTGTTGTCAGCAGGG - Intergenic
953752722 3:45621433-45621455 GTCTTACTCTGTTGCCAGGCTGG + Intronic
954026321 3:47786029-47786051 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
954299971 3:49695740-49695762 GTGGCACCCTGTGGGCAGCCAGG + Intronic
954322083 3:49839157-49839179 GTCTTACTCTGTTGCCAGGCTGG - Intronic
954388331 3:50256014-50256036 GTGTTACTCTGTTGCCAGGCTGG - Intronic
954894359 3:53963376-53963398 GTGGTTCTCAGGTGGCGGCCGGG + Intergenic
956076957 3:65516207-65516229 GTTTTGCTCTGTTGGCAGGCTGG + Intronic
956869233 3:73400305-73400327 GTAGAACTCTGTTGGCAACCTGG + Intronic
957154757 3:76533746-76533768 GTGGTTATCTGTTGTCAGCAGGG + Intronic
957155374 3:76537849-76537871 GTGGTTATCTGTTGTCAGCAGGG + Intronic
958797648 3:98723227-98723249 GTCTTGCTCTGTTGGCAGGCTGG + Intergenic
959266061 3:104140292-104140314 GTGGAAATGTGTTGGCAGGCTGG - Intergenic
959636615 3:108580656-108580678 GTCTTACTCTGTTGCCAGGCTGG + Intronic
959656244 3:108808165-108808187 GTCTTACTCTGTTGCCAGTCTGG - Intergenic
960629203 3:119712025-119712047 TTAGTACTCTTATGGCAGCCAGG - Intronic
965456177 3:168903426-168903448 GTCTTGCTCTGTTGGCAGGCTGG - Intergenic
965983267 3:174719821-174719843 GTCTTGCTCTGTTGCCAGCCTGG + Intronic
968143223 3:196275701-196275723 GTCTTACTCTGTTGCCAGGCTGG - Intronic
969374201 4:6752507-6752529 GTCATGCTCTGTTGCCAGCCTGG - Intergenic
972451832 4:39208499-39208521 GTTGTACCATGTTGGCAGGCTGG + Intronic
972599819 4:40562259-40562281 GTGGTCCTCTTTTGGAAGCCTGG + Intronic
973952786 4:56034754-56034776 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
978807701 4:112818060-112818082 GTGGTGCTCTGTGGGCAGCTGGG + Intergenic
979861202 4:125695937-125695959 GTCGTGCTCTGTTGCCAGGCTGG - Intergenic
980638502 4:135540510-135540532 GTCTTGCTCTGTTGCCAGCCTGG + Intergenic
982947350 4:161641519-161641541 TTGAGACTCTGTTGCCAGCCTGG + Intronic
987103826 5:14617369-14617391 GTCTCACTCTGTTGGCAGGCTGG - Intergenic
987287075 5:16467070-16467092 TTGGTTTTCTCTTGGCAGCCTGG - Intergenic
988395336 5:30690823-30690845 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
988794091 5:34636287-34636309 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
989017500 5:36956199-36956221 GTCTTACTCTGTTGCCAGGCTGG - Intronic
990131319 5:52589435-52589457 GTCTTATTCTGTTGTCAGCCTGG + Intergenic
990404070 5:55470135-55470157 GGGTTCCTCTGTTGGCAGTCAGG - Intronic
998313409 5:141157284-141157306 GTTGTACTCGGTTTTCAGCCTGG - Intergenic
998320384 5:141224791-141224813 GTTGTACTCGGTTTTCAGCCTGG - Exonic
999841685 5:155434397-155434419 GTGGAACTCTCTAGGCAGGCAGG + Intergenic
1000224941 5:159251496-159251518 GTCTTACTCTGTTGCCAGGCGGG - Intergenic
1000542690 5:162559608-162559630 GTGTTGCTCTGTTGCCAGTCTGG - Intergenic
1002119200 5:176988711-176988733 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1002732656 5:181353045-181353067 GTGGTATTCAGCTGGCAGCTGGG + Intergenic
1002751882 6:121061-121083 GTGGTATTCAGCTGGCAGCTGGG - Intergenic
1002911768 6:1496249-1496271 GTGGTATTCAGTGGGCAGACTGG - Intergenic
1004176529 6:13344891-13344913 GTCTCACTCTGTTGACAGCCTGG + Intergenic
1004393685 6:15230124-15230146 GTCTTGCTCTGTTGGCAGGCTGG + Intergenic
1005945650 6:30593570-30593592 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1006345555 6:33479029-33479051 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1006872368 6:37263611-37263633 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1007439862 6:41849635-41849657 GTGTTGCTCTGTTGCCAGGCTGG + Intronic
1008222131 6:48867760-48867782 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1008534331 6:52495616-52495638 GTCTTACTCTGTTGCCAGACTGG + Exonic
1010225028 6:73481002-73481024 GTGTTGCTCTGTTGCCAGGCTGG + Exonic
1010512605 6:76738997-76739019 ATGGTACTCTGAAGGCAGGCTGG + Intergenic
1013064480 6:106670573-106670595 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1013645976 6:112141720-112141742 GTGGAAATTTGTTGGCTGCCAGG + Intronic
1013789780 6:113823535-113823557 GTGTCACTCTGTTGCCAGGCTGG - Intergenic
1014376163 6:120677507-120677529 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1014823924 6:126026413-126026435 GTCTTACTCTGTTGCCAGGCTGG + Intronic
1016056589 6:139584261-139584283 GTGGTATTCTGTTATCAGTCTGG + Intergenic
1018087082 6:160312147-160312169 GTCTCACTCTGTTGCCAGCCTGG + Intergenic
1018566421 6:165159371-165159393 GAAGATCTCTGTTGGCAGCCTGG - Intergenic
1018568366 6:165182082-165182104 GTGGTAATGATTTGGCAGCCTGG + Intergenic
1019236911 6:170625363-170625385 GTGGTATTCAGCTGGCAGCTGGG + Intergenic
1019312226 7:368462-368484 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1019356871 7:584806-584828 GGGGAACTCTGCTGCCAGCCAGG - Intronic
1020236422 7:6359354-6359376 GTCTCACTCTGTTGTCAGCCTGG + Intergenic
1021676712 7:23087398-23087420 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1022082356 7:27035290-27035312 GTCTTGCTCTGTTGCCAGCCTGG - Intergenic
1022412118 7:30147399-30147421 GTGGTTCTCTGATGGCTCCCGGG + Intronic
1024196408 7:47063790-47063812 CTGTTACTCTTCTGGCAGCCTGG + Intergenic
1024197883 7:47077353-47077375 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1026128159 7:67597736-67597758 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1026659683 7:72289566-72289588 GTGGTACCATGTTGGGAGCTTGG - Intronic
1026714009 7:72770397-72770419 GTCTCACTCTGTTGCCAGCCTGG - Intronic
1028830928 7:95325800-95325822 GTGGTATTCAGTTGGTGGCCAGG - Intergenic
1029695525 7:102210719-102210741 CTGATACTCTGTTGGCTGACTGG - Intronic
1030722136 7:112882657-112882679 GTCTTGCTCTGTTGGCAGGCTGG - Intronic
1031757709 7:125666859-125666881 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1031809712 7:126351321-126351343 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
1033099616 7:138459703-138459725 GAGGTACTCTGGAGGCAGCAGGG - Intergenic
1033933963 7:146559537-146559559 GTGTTGCTCTGTTGCCAGGCTGG - Intronic
1035510859 8:181247-181269 GTGGTATTCAGCTGGCAGCTGGG - Intergenic
1035794768 8:2344594-2344616 ATAGTATTCTGTTAGCAGCCTGG + Intergenic
1036051545 8:5204935-5204957 CTGGTACTCTACTGGCAGTCAGG + Intergenic
1036578083 8:10047511-10047533 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1037436428 8:18868566-18868588 GTGCTGCTCTGTTGTCAGCAGGG - Intronic
1039240916 8:35555794-35555816 GTCTTGCTCTGTTGGCAGGCTGG - Intronic
1039728304 8:40246371-40246393 GTGACGCTCTGTTGCCAGCCTGG - Intergenic
1039988208 8:42465659-42465681 GTGTCACTCTGTTGCCAGGCTGG - Intronic
1041787161 8:61647935-61647957 GAGATACTCTGCTGGAAGCCAGG - Intronic
1042731570 8:71940821-71940843 GTGGCACCCTGTTGGGATCCTGG - Intronic
1044987564 8:97768694-97768716 GTCTTACTCTGTTGCCAGGCTGG - Intergenic
1045350866 8:101338483-101338505 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1045442649 8:102229221-102229243 GTTGCACTCTGTTGCCAGGCTGG - Intronic
1045603265 8:103744073-103744095 GTGTTGCTCTGTTGCCAGGCTGG + Intronic
1047593346 8:126350717-126350739 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
1047684578 8:127291883-127291905 GTGGTACTCAGCTGGCAGGTGGG - Intergenic
1048536597 8:135302194-135302216 GTCCTACTCTGTTGCCAGGCTGG + Intergenic
1048706717 8:137161848-137161870 GTGGTCCTCTTCTGGCAGCATGG - Intergenic
1050818922 9:9853576-9853598 GTGTCACTCTGTTGCCAGGCTGG + Intronic
1054728261 9:68674543-68674565 GTGGTATTCAGCTGGCAGACAGG - Intergenic
1056652356 9:88477055-88477077 GTGCTTCACTGTGGGCAGCCAGG + Exonic
1056851242 9:90086366-90086388 ATGGTACTGGGGTGGCAGCCTGG + Intergenic
1057443785 9:95099707-95099729 GTGGTGCTTTCTGGGCAGCCAGG - Exonic
1057467370 9:95327299-95327321 GTGTTGCTCTGTTGCCAGGCTGG - Intergenic
1057974743 9:99593457-99593479 GAGGTACTCTGTTGGAAGGCTGG - Intergenic
1059265142 9:113021604-113021626 GTGTTGCTCTGTTGCCAGGCTGG + Intergenic
1059553239 9:115251448-115251470 GTTATACTCTGTTGTCAGCAGGG - Intronic
1060283972 9:122232682-122232704 GTGTCACTCTGTTGCCAGGCTGG - Intergenic
1060556492 9:124510393-124510415 GTCTTGCTCTGTTGCCAGCCTGG - Intergenic
1061978822 9:134088061-134088083 GTGGTACACTGTCAGCAGCAAGG - Intergenic
1062265222 9:135683796-135683818 GTGGGACTCTGTTGGATGTCAGG - Intergenic
1062757062 9:138305369-138305391 GTGGTATTCAGCTGGCAGCTGGG + Intergenic
1187471343 X:19571872-19571894 GTGATACCCTGTGGGCAGCTGGG + Intronic
1188586187 X:31778598-31778620 GTGTTGCTCTGTTGCCAGGCTGG + Intronic
1188896723 X:35678179-35678201 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
1189705664 X:43756420-43756442 GTCCTACCCTGTTGTCAGCCTGG - Intergenic
1190825145 X:54010954-54010976 GTGGTAGTCAGTGGGCAGCATGG - Intronic
1192111994 X:68374324-68374346 GTCTCACTCTGTTGCCAGCCTGG - Intronic
1193747243 X:85297664-85297686 GTGGTACTCTGTGGGGACCAGGG + Intronic
1193905155 X:87234728-87234750 GTGTCACTCTGTTGCCAGGCTGG + Intergenic
1195058137 X:101166787-101166809 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1195624099 X:106989992-106990014 GTTTTACCATGTTGGCAGCCAGG - Intronic
1196831659 X:119780666-119780688 GTCTTGCTCTGTTGGCAGGCTGG + Intergenic
1198187663 X:134269568-134269590 GTCTCACTCTGTTGCCAGCCTGG - Intergenic
1198441020 X:136663511-136663533 GTCTTACTCTGTTGCCAGGCTGG + Intergenic
1199947333 X:152679894-152679916 GTGGTCCTGGGTTGGCAGCAGGG - Intergenic
1199962347 X:152788560-152788582 GTGGTCCTGGGTTGGCAGCAGGG + Intergenic
1200742653 Y:6870869-6870891 GTGGAACTCTGGTTGCACCCGGG + Intronic