ID: 1101823294

View in Genome Browser
Species Human (GRCh38)
Location 12:108200851-108200873
Sequence CTAGGCTTCCCCAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101823294_1101823302 19 Left 1101823294 12:108200851-108200873 CCTTCTGCCCTGGGGAAGCCTAG 0: 1
1: 0
2: 0
3: 22
4: 242
Right 1101823302 12:108200893-108200915 TCGCCGGTACAAGGAAACCCAGG 0: 1
1: 0
2: 0
3: 0
4: 21
1101823294_1101823304 28 Left 1101823294 12:108200851-108200873 CCTTCTGCCCTGGGGAAGCCTAG 0: 1
1: 0
2: 0
3: 22
4: 242
Right 1101823304 12:108200902-108200924 CAAGGAAACCCAGGCAGCACTGG 0: 1
1: 0
2: 2
3: 31
4: 314
1101823294_1101823299 3 Left 1101823294 12:108200851-108200873 CCTTCTGCCCTGGGGAAGCCTAG 0: 1
1: 0
2: 0
3: 22
4: 242
Right 1101823299 12:108200877-108200899 TGAGCAGGAAATTCCATCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 95
1101823294_1101823300 10 Left 1101823294 12:108200851-108200873 CCTTCTGCCCTGGGGAAGCCTAG 0: 1
1: 0
2: 0
3: 22
4: 242
Right 1101823300 12:108200884-108200906 GAAATTCCATCGCCGGTACAAGG 0: 1
1: 0
2: 0
3: 3
4: 21
1101823294_1101823305 29 Left 1101823294 12:108200851-108200873 CCTTCTGCCCTGGGGAAGCCTAG 0: 1
1: 0
2: 0
3: 22
4: 242
Right 1101823305 12:108200903-108200925 AAGGAAACCCAGGCAGCACTGGG 0: 1
1: 0
2: 6
3: 35
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101823294 Original CRISPR CTAGGCTTCCCCAGGGCAGA AGG (reversed) Intronic
900656908 1:3763049-3763071 CGGGGCACCCCCAGGGCAGAGGG - Intronic
900816520 1:4851412-4851434 CTAAGTTTCCCCAGGTCACAGGG - Intergenic
900934837 1:5758700-5758722 CTAGTCTTCCCCAGGCCATGGGG - Intergenic
901126781 1:6934842-6934864 TGAGGCTTCCCCTGGGGAGAAGG + Intronic
901931873 1:12601176-12601198 GTCGGCTTCTGCAGGGCAGATGG - Intronic
902324345 1:15689330-15689352 CTAGGCATCCCCAAGGAAGTGGG + Intronic
903264840 1:22151705-22151727 CCAAGCTTCCCCAGGGCAATGGG - Intergenic
903454414 1:23477258-23477280 CTCAGCCTCCCCAAGGCAGATGG - Intronic
903859086 1:26354394-26354416 GCATCCTTCCCCAGGGCAGAGGG - Intergenic
904350067 1:29899263-29899285 CTGGGCTTCCCCAGAGTAGAGGG + Intergenic
904659958 1:32076888-32076910 CTTGGCATCCCCAGGGGAAAAGG - Intronic
904921385 1:34010945-34010967 CTAGGCCTTCCCAAGGCAGAAGG - Intronic
905797592 1:40824240-40824262 CTACCTTTCCCCAGGGCAGAAGG - Exonic
906127707 1:43437678-43437700 CGAGGCTTCCTCAGAGTAGATGG - Exonic
907381505 1:54094636-54094658 CTAGGCTGCCCAAGGGCCCAAGG + Intronic
915249401 1:154577694-154577716 CTTGGTTTCCTCAGGGAAGAGGG - Exonic
915895838 1:159809969-159809991 TGAGGCTCCCCCAGGCCAGACGG + Intronic
916689508 1:167177070-167177092 CTAGGTTTCAACAGGGTAGAGGG - Intergenic
917348727 1:174055911-174055933 CAAAGCTTCCACAGGGTAGAAGG + Intergenic
918392262 1:184078564-184078586 CTGAGCTTCCCCAGCACAGAGGG - Intergenic
920119040 1:203641961-203641983 CTAGGCTTCCCAATGTCAGAGGG + Intronic
920741666 1:208586703-208586725 TCAGGCTCCCCCAGGGCAGGGGG - Intergenic
921272870 1:213488430-213488452 CTAGGCTTCCCACTGGCAGGAGG + Intergenic
922211579 1:223490563-223490585 CTGGGTTTCCCCAAGTCAGATGG - Intergenic
922349489 1:224723584-224723606 CTGGGCCTCCCCAGGCCAGGAGG + Intronic
922483340 1:225954850-225954872 GGAGGCTTCCTCAGGACAGAAGG - Intergenic
922731168 1:227949383-227949405 CCAGGCTTTCCCAGGGAAGCAGG - Intergenic
923800537 1:237204923-237204945 CCAGGCTTCCCTACAGCAGAAGG + Intronic
1063067434 10:2623837-2623859 CTGGGCTTCCCCACCGCAGGTGG - Intergenic
1063848862 10:10161912-10161934 CAAAGCTTCCACAGTGCAGAAGG - Intergenic
1065240831 10:23702456-23702478 ATAGGTTTCCCCAAGGCAGCTGG - Intronic
1066235311 10:33479980-33480002 CAAAGCTTCCACAGTGCAGAAGG + Intergenic
1067031301 10:42879994-42880016 CAAGGCTTCCTCAGGGCACGCGG + Intergenic
1067463020 10:46472078-46472100 CCAGGCTCCCCCACGCCAGATGG - Intergenic
1067624174 10:47912560-47912582 CCAGGCTCCCCCACGCCAGATGG + Intergenic
1069606906 10:69744459-69744481 CTTGGATTCCCCAGGGAAGGAGG - Intergenic
1069895992 10:71680343-71680365 TTAGGTGCCCCCAGGGCAGAAGG + Intronic
1069906589 10:71735851-71735873 CTATGCTCCCCAAGGGCAGCCGG + Intronic
1070158164 10:73849153-73849175 CTAGGCTTCCTCTGGGCTGCAGG - Intronic
1070340840 10:75496944-75496966 CTAGGATTCCTGAGGGGAGAGGG - Intronic
1070782810 10:79147339-79147361 CTCGGCTCCCCCTGGTCAGAAGG - Intronic
1070918948 10:80172065-80172087 CTAGGAGTCCCCTGGGGAGAGGG + Intronic
1072635297 10:97174001-97174023 CTAGGCTGCTCCAGGCCAGAAGG - Intronic
1075344660 10:121673371-121673393 CTGGGCTTACCCAGGGAGGAGGG - Intergenic
1076629698 10:131844877-131844899 CAAGGCTTCTCCAGGACAGCAGG - Intergenic
1077017840 11:404753-404775 CTTGGCTTCCGCAGGGCAGGGGG + Exonic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1078543507 11:12229715-12229737 CCAGGCCTCCCAAGGGCTGAGGG + Intronic
1079034324 11:17009066-17009088 TTAGGCTTCCCCAAGGCTTATGG - Intronic
1085387079 11:76163593-76163615 CTGGGCTCCCCCAGAGCGGAGGG + Intergenic
1087050610 11:93882827-93882849 CATGGCATCTCCAGGGCAGAGGG + Intergenic
1090208281 11:124897664-124897686 CAAGGCCTGCTCAGGGCAGAAGG - Intronic
1090302432 11:125655326-125655348 CCAGGATTCCCCAGAGCCGATGG - Exonic
1090739606 11:129645512-129645534 CTAGCCTTCCCCGTGGGAGAAGG + Intergenic
1090798971 11:130159297-130159319 CTGGGCCTCCCCAGGGTAGCCGG + Intergenic
1090818109 11:130315843-130315865 CTTGGCTTCCCCTGGCCAGGCGG + Intergenic
1097052251 12:56230569-56230591 TGTGGCTTTCCCAGGGCAGAGGG + Intronic
1097218273 12:57430846-57430868 CGGGGCTTCCCCGGGGCCGAGGG + Exonic
1100051079 12:90448197-90448219 CAAAGCTTCCACAGCGCAGAAGG + Intergenic
1100193369 12:92217115-92217137 CTAATCTTCCCCAGAGCAAAAGG - Intergenic
1100208571 12:92377584-92377606 CTAGGCTTGCTCAAGGCAGTTGG + Intergenic
1101823294 12:108200851-108200873 CTAGGCTTCCCCAGGGCAGAAGG - Intronic
1102270593 12:111531487-111531509 ACAGGCTTCCCCAGGGAAGTGGG + Intronic
1102556171 12:113728116-113728138 TGAGGCTTCCCCAGGCCAGGGGG + Intergenic
1103508195 12:121455298-121455320 CTGGGCTGCCCCAGAGCAGAGGG - Intronic
1104729195 12:131095609-131095631 CTGGACGTTCCCAGGGCAGATGG + Intronic
1107575058 13:41709672-41709694 TGACTCTTCCCCAGGGCAGATGG + Intronic
1108979521 13:56492597-56492619 CTGGGCTTGCCCAGGACAGCAGG + Intergenic
1109889858 13:68596925-68596947 GAAAGCTTCTCCAGGGCAGATGG + Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1116974023 14:51095625-51095647 CTAGGCTTCTGCACGGCAGTGGG + Exonic
1117284315 14:54272079-54272101 CTTGGCTTCCCCAGGATTGAGGG + Intergenic
1118018945 14:61691200-61691222 CTAGCCTTCCACAGGGGAGAAGG - Intergenic
1118316918 14:64731215-64731237 CCAGGCTTCCGCTGGGAAGAGGG + Intronic
1118768580 14:68926770-68926792 TTAGAGTTCCCCAGGGCAGGAGG - Intronic
1119730539 14:76948278-76948300 ATAGGAGTCCCCGGGGCAGAGGG + Intergenic
1120078635 14:80189028-80189050 CTAGCCTTCCACATGGGAGAAGG + Intergenic
1121957627 14:98228515-98228537 CCAGGACTCCCCAGGGCAGGCGG + Intergenic
1122627203 14:103090734-103090756 CCAGGCTGGCCAAGGGCAGAGGG - Intergenic
1122843802 14:104479711-104479733 AGAGGGTTCCCCAGGGCAGGGGG - Intronic
1123116308 14:105895701-105895723 CCGGGTTTCCCCAGGCCAGATGG - Intergenic
1126794121 15:52245806-52245828 CTGGACTTCCACAGGGCAGTGGG + Intronic
1127457862 15:59171301-59171323 CTTGGCTTCCTCTCGGCAGAAGG - Intronic
1131015001 15:89050741-89050763 CTTGCCTTCCTCAGGGCTGAGGG - Intergenic
1131969373 15:97876347-97876369 CAAAGCTTCCACAGGGCGGAAGG - Intergenic
1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG + Intronic
1132724774 16:1333912-1333934 CTCAGTTTCCCCAGGGCCGAGGG - Intronic
1132774628 16:1586191-1586213 CTGGGCAGCCCCGGGGCAGAGGG - Exonic
1133607058 16:7398117-7398139 CTAGGATTCCACATGGAAGAAGG + Intronic
1133805776 16:9125130-9125152 CTGGGTGTCCCCAGGGCACAAGG - Intergenic
1135189074 16:20340027-20340049 AAAGGCTTGCCCAGGGCAGCAGG - Intronic
1135942568 16:26835682-26835704 CAAAGCTTCCACAGTGCAGAAGG + Intergenic
1135953194 16:26934477-26934499 CAAGTCTTCCCAAGGGTAGATGG + Intergenic
1137369956 16:47895973-47895995 GCAGGCTTCCCCAGAGCAGTGGG - Intergenic
1138844871 16:60553772-60553794 CTAGACTCCCCCAGGGCCCAGGG - Intergenic
1141031311 16:80591495-80591517 CTGGGCTTTGCCAGGACAGATGG - Intergenic
1142066548 16:88066096-88066118 CGAGGCGGCCTCAGGGCAGACGG + Intronic
1142323736 16:89400958-89400980 CCAGGCAGCCCCGGGGCAGACGG - Intronic
1203093257 16_KI270728v1_random:1229910-1229932 CTGGGCTTCCCCCGAGCAGGTGG + Intergenic
1143033679 17:3982356-3982378 GAAGGTTTCCCCTGGGCAGAAGG - Intergenic
1143897345 17:10146300-10146322 CTAGGGTTGCCCCGGGAAGAAGG - Intronic
1144758804 17:17695399-17695421 AGAGGCTCCCCCAGGGCAGGCGG - Intronic
1147141523 17:38463237-38463259 CAGGGCATCCCCAGGGCAAAGGG - Intronic
1148204434 17:45771073-45771095 CTGGGCTTTCCCAGGGCTTAGGG + Intergenic
1148456613 17:47814646-47814668 CTGGGCCTCCCCCGGGCAGCTGG + Intronic
1148903877 17:50899278-50899300 TCTGGCTTCCCCAGGGCACAGGG + Intergenic
1152043900 17:77923592-77923614 CTGGGGTACCCCAGGGGAGAAGG - Intergenic
1152256445 17:79242761-79242783 CTGGGCCTCCACAGGGCAGCAGG + Intronic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152448781 17:80363328-80363350 CAAGGCTTGCTCAGGGCAGGCGG - Intronic
1153356523 18:4143216-4143238 CTAGACCTCCCCAGGACAAAGGG - Intronic
1156341135 18:36211654-36211676 GTGGGATTCCCCAGGGCTGAGGG + Intronic
1161299449 19:3535822-3535844 CTTGGCTTCCCCACGGCTGTTGG - Intronic
1162135955 19:8555455-8555477 CTGAGCTTCCCCAGGACAGAGGG + Intronic
1166694870 19:44846665-44846687 CTCGGCTTCCCCAGCTCGGAAGG - Intronic
1167299835 19:48672110-48672132 CCAGAGTTCCCCAGAGCAGATGG + Intronic
1167507660 19:49879387-49879409 CTGCGCTGCCCCAGGGCAGGAGG + Intronic
1167566317 19:50259364-50259386 CTCAACTTCCCCAGCGCAGAAGG - Intronic
1168294092 19:55370324-55370346 CAGGGGTTCCCCAGGGCAGGGGG + Exonic
927099250 2:19775339-19775361 CTAAGCTGCCCCAGAGCACACGG - Intergenic
928170885 2:29002432-29002454 CCAGTCCTTCCCAGGGCAGAAGG + Intronic
929070198 2:38021386-38021408 CAAAGCTTCCACAGTGCAGAGGG - Intronic
929618361 2:43330239-43330261 CTAGGACTCCCCAAGCCAGACGG - Intronic
930386833 2:50707584-50707606 CCAGGCTTCATCAGGGCAGCAGG - Intronic
930952193 2:57156301-57156323 CTGGGCTTGCCCAGGGCAGCGGG + Intergenic
933082304 2:78006277-78006299 CTATGCTTCACCAAGGCAGGAGG - Intergenic
936650482 2:114420925-114420947 TTGGGCTTCTCCAGGGCATATGG + Intergenic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
940910438 2:159205248-159205270 CAAGGCTGCCCCAGAGCACAGGG + Intronic
946012657 2:216578772-216578794 CCAGGCTTGCTTAGGGCAGAAGG - Intronic
946155491 2:217804217-217804239 CTTGGATTCCCCTGGGTAGATGG - Exonic
946476605 2:220011995-220012017 CTAGGATTCCCCAGGGTGAAAGG - Intergenic
947502486 2:230681594-230681616 CTAGGATTACCCAGTGAAGATGG + Intergenic
948149775 2:235736048-235736070 CTGTGCTTCCCCAGGACACAAGG - Intronic
948201380 2:236131949-236131971 CCAGGCTGCCCCAGGCCCGAGGG + Intergenic
948248598 2:236507202-236507224 GTGGGCTTCCCCAAGCCAGAAGG - Intronic
948454878 2:238100308-238100330 ATAAGCTGCCACAGGGCAGATGG - Exonic
948482083 2:238256577-238256599 CCAGGCCTGCCCAGGGAAGAGGG + Intronic
1169685298 20:8264884-8264906 CTACATTTCCCCAGGGCAGTAGG - Intronic
1176663603 21:9663638-9663660 CAAAGCTTCCACAGTGCAGAAGG + Intergenic
1178637046 21:34313262-34313284 CTAGGCATGCCCACTGCAGAGGG + Intergenic
1179481001 21:41678657-41678679 CTGGACTTCTCCAGGGCAGGCGG + Intergenic
1180212233 21:46301936-46301958 CCAGGCTTCCTCAGGGCTGTGGG - Exonic
1181097881 22:20518459-20518481 CAAAGCTTCACCAGGGAAGAGGG - Intronic
1181235047 22:21443646-21443668 ACAGGCTTCCACAGGGCAGGGGG - Intronic
1181464681 22:23104480-23104502 CTAGGCTTGCCCAGGCCAGTGGG + Intronic
1182085347 22:27557357-27557379 CTAAGTTCCCCCAAGGCAGAGGG - Intergenic
1183588104 22:38764698-38764720 CTAGTTCTCACCAGGGCAGAGGG - Intronic
1183654581 22:39177265-39177287 CCAGGCTCCCCAAGGGCAGAGGG - Intergenic
1184690868 22:46116696-46116718 CGAGGCTTCCACAGCCCAGAAGG - Intergenic
1184735771 22:46396987-46397009 CCAGGCTGCCCCAGGACACATGG + Intronic
1185287557 22:50009350-50009372 CCAGGCTCCCACGGGGCAGAAGG + Intronic
950424040 3:12915047-12915069 CTGGGCCTCCCCAGGGCGGCGGG + Intronic
950468876 3:13172584-13172606 CAACACTTCCCGAGGGCAGATGG + Intergenic
950657378 3:14444984-14445006 CCAGGCCTGCCCAGGGCAGGAGG - Intronic
951523304 3:23629538-23629560 CTAGGCTTACCCAGGGTGAAGGG - Intergenic
952513314 3:34078612-34078634 CTACTCTTCCACAGGGGAGAGGG - Intergenic
953041851 3:39262580-39262602 CTGGGCTTCCCAAGAGCAGAGGG - Intergenic
953711399 3:45274029-45274051 CTATGTATCCCAAGGGCAGAGGG + Intergenic
954807921 3:53231009-53231031 CTAGCCTTTCCCAGGTCAGGTGG + Intronic
955905289 3:63801075-63801097 TTTCCCTTCCCCAGGGCAGACGG - Intergenic
958993581 3:100875650-100875672 CAAGGCTTTTCCAGTGCAGATGG - Intronic
959227379 3:103603122-103603144 CAAGGCTGCCCCAGGACAAAGGG + Intergenic
959536603 3:107493365-107493387 CCAGGCTTCTCCTGGGCACATGG + Intergenic
961315639 3:126033542-126033564 CCAGGCTTCCCCAGGTGGGAAGG - Intronic
961447725 3:126988675-126988697 GCAGGCTTGCCCAGGGCAGGCGG + Exonic
962989780 3:140567217-140567239 CTGGGCTCCCCCAGGACAGAGGG + Exonic
963336793 3:143984512-143984534 CTAGCCATCCCCAGGGAACAGGG - Intronic
964296425 3:155239370-155239392 CTTGGCCTCTCCAGGGCAGCAGG - Intergenic
965220075 3:165918006-165918028 CAAAGCTTCCACAGAGCAGAGGG + Intergenic
967153876 3:186674828-186674850 CTGGGCTTCCCCATGGGTGATGG - Intronic
967221498 3:187251556-187251578 CTGCCCCTCCCCAGGGCAGATGG - Intronic
967952781 3:194853546-194853568 CAATTCCTCCCCAGGGCAGAGGG + Intergenic
968503118 4:960319-960341 CCAGGCCCCCACAGGGCAGAGGG + Exonic
968951983 4:3700087-3700109 CTGGGCATCCCCAGTGCAGAGGG + Intergenic
969533266 4:7740985-7741007 CTGGTTCTCCCCAGGGCAGACGG + Exonic
976102622 4:81581299-81581321 CAAAGCTTCCACAGTGCAGAAGG - Intronic
977002247 4:91518900-91518922 TTAGGCTTTCCCAGGGAAGATGG + Intronic
978060286 4:104328258-104328280 GTAGGATTCCCTCGGGCAGAGGG + Intergenic
982168973 4:152643283-152643305 CCAGGCTTCCCTAGAGCATAAGG - Intronic
982657800 4:158170946-158170968 ATCGGCTGCCCCAGGGCAGGAGG - Exonic
983900518 4:173128599-173128621 TAAGGCTTCCCCAGGGAAGCTGG - Intergenic
984798506 4:183689545-183689567 CTAAGCTCCACAAGGGCAGAAGG + Intronic
985411705 4:189692295-189692317 CAAAGCTTCCACAGTGCAGAAGG - Intergenic
985974442 5:3405109-3405131 CTTGGGTTTCCCAGGTCAGAAGG + Intergenic
985974451 5:3405137-3405159 CTTGGGTTTCCCAGGTCAGAAGG + Intergenic
985974460 5:3405165-3405187 CTTGGGTTTCCCAGGTCAGAAGG + Intergenic
987488691 5:18551247-18551269 CAAAGCTTCCACAGTGCAGAAGG + Intergenic
987847019 5:23300481-23300503 CTTGGCTTCCCCAAAGCAAATGG + Intergenic
989188358 5:38646077-38646099 CTTAGATTCCCCAGGGCTGAGGG - Intergenic
989201996 5:38772922-38772944 CAAGGGTTCCCCAGGATAGATGG - Intergenic
990977947 5:61575415-61575437 CAAGGCTGCTCCAGGGCAGGGGG - Intergenic
994096512 5:95852250-95852272 CAAAGCTTCCACAGTGCAGAAGG - Exonic
997294738 5:132762359-132762381 CTTAGCTTCTCCAGGACAGAAGG - Intronic
1000925870 5:167193356-167193378 CTAAGTTTCCCCAGTGCATATGG - Intergenic
1001528456 5:172445723-172445745 TCAGGCTTTCCCAGGGCTGAGGG - Intronic
1002314747 5:178336061-178336083 CTAGGCTTCCCTTGGGCACCTGG - Intronic
1002483150 5:179516766-179516788 CTGAGCATCCCCAGGACAGAGGG + Intergenic
1002681501 5:180969036-180969058 CAAAGCTTGCCCAGGGCAGAAGG + Intergenic
1003947428 6:11088180-11088202 CAAAGCTTCCCAAGGGCAGAAGG - Intergenic
1003953425 6:11140684-11140706 ATAGGATTCCCCAGGGTAGGGGG + Intergenic
1004235385 6:13871172-13871194 CAAAGCTTCCACAGTGCAGAAGG + Intergenic
1006222224 6:32500839-32500861 CAAAGCTTCCACAGCGCAGAAGG - Intergenic
1006981905 6:38154097-38154119 CTAGGGCAACCCAGGGCAGAGGG + Exonic
1013720399 6:113019303-113019325 CTAGCCTTCCACAGGAGAGAAGG + Intergenic
1015010341 6:128338662-128338684 CTATGCTTCCCCTCTGCAGAAGG + Intronic
1016693592 6:146966482-146966504 TGAGGCCTCCCCAGAGCAGAAGG + Intergenic
1018862716 6:167722766-167722788 CTCTGGCTCCCCAGGGCAGAGGG + Intergenic
1018920237 6:168167535-168167557 CTAGGATATCCCAGGACAGAGGG + Intergenic
1019996584 7:4728528-4728550 CGTGGCTCCCACAGGGCAGAGGG - Intronic
1019999913 7:4749760-4749782 CAAGCCTTCCCCAGGGCACAGGG - Intronic
1020179821 7:5913669-5913691 CTGGGCTTCCACAGGGCTGTGGG - Intronic
1020303115 7:6811215-6811237 CTGGGCTTCCACAGGGCTGTGGG + Intronic
1021111997 7:16706204-16706226 ATAGGCTTCCCTTGTGCAGAGGG + Exonic
1023978974 7:45054853-45054875 ACAGGGTTCCCCAGGGCAGATGG + Intronic
1024188537 7:46980999-46981021 ATAGGCTTCCCAAGGTCAGGAGG - Intergenic
1025859181 7:65310426-65310448 CTAGGCTTCCCATAGGCATAAGG + Intergenic
1026328914 7:69335294-69335316 CTAGGCTCCCCCAAAGCACAAGG + Intergenic
1026566904 7:71496673-71496695 TTATGCTTCCTCAGGGCAGCTGG - Intronic
1029962690 7:104705669-104705691 CTAGGGTTCCCCAGGCCATGAGG + Intronic
1030304128 7:108002541-108002563 CTGGGTTTCCCCACCGCAGAGGG - Intronic
1032522302 7:132554627-132554649 CCAGGGTGCCTCAGGGCAGAGGG + Intronic
1034215747 7:149404530-149404552 CTTGGCTTGCCCATGGCAGGTGG - Intergenic
1034962751 7:155372730-155372752 CGAGGCCTCCCCAGGGGAGGTGG - Intergenic
1035755743 8:2030777-2030799 CGAGGCTTCCCAAGGCCGGAGGG + Intergenic
1037730280 8:21518184-21518206 TTTGGCTTCCCTTGGGCAGAGGG - Intergenic
1037933146 8:22895990-22896012 CAAATCTGCCCCAGGGCAGAGGG - Intronic
1038481509 8:27905000-27905022 CTTGGGGTACCCAGGGCAGATGG - Intronic
1040026678 8:42787604-42787626 CAAAGCTTCCGCAGTGCAGAAGG - Intronic
1043394475 8:79823395-79823417 CAAAACTTTCCCAGGGCAGAGGG - Intergenic
1043513886 8:80977967-80977989 CCTGGCTTCCCAAGGGCTGAGGG + Intronic
1044600537 8:93999397-93999419 CAAAGCTTCCACAGCGCAGAAGG - Intergenic
1047406644 8:124590832-124590854 CGAGGCTCCCGCAGGGCAGTGGG + Intronic
1048186762 8:132249183-132249205 CAAAGCTTCCACAGTGCAGAAGG + Intronic
1049242863 8:141547480-141547502 CAAGCGCTCCCCAGGGCAGAGGG - Intergenic
1049520087 8:143083379-143083401 CTGGGTTTCCCTTGGGCAGAGGG - Intergenic
1049778926 8:144418639-144418661 GCCGGCTTCCCCAGAGCAGACGG + Intergenic
1051357535 9:16253564-16253586 CAGGGCTTCCCCAGTCCAGAGGG - Intronic
1052633532 9:31071558-31071580 CAAGGCTTAGCCAGTGCAGAGGG - Intergenic
1053072647 9:35110377-35110399 CCTGGCTTCCCCAGGGCAAGGGG - Exonic
1053413108 9:37928452-37928474 CGAGTATTCCCCAGGGAAGAGGG - Intronic
1054849796 9:69835952-69835974 CAAGGCTGCCCCAAGCCAGAGGG - Intronic
1055581392 9:77710541-77710563 CTAGCTTTCCCCATGGGAGAAGG - Intergenic
1056101914 9:83308125-83308147 CTGGGTTTTCCCAGGGCTGATGG + Intronic
1057444746 9:95105654-95105676 CTAGAGTTTCCCAAGGCAGAGGG - Intronic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057593598 9:96395261-96395283 CTCAGCTTCCCCTGGTCAGACGG + Intronic
1057805928 9:98220036-98220058 CTAGGCTTCCCCACCCCACAGGG - Intronic
1059345130 9:113623215-113623237 CTGGGCTTGCCCAGGGCCCATGG - Intergenic
1059429272 9:114240422-114240444 CCAGGCTTACCCTGGGGAGAAGG - Exonic
1060020506 9:120126372-120126394 ATAAGTTTCCCCAGGGCAAAGGG + Intergenic
1060594076 9:124838127-124838149 CAAAGCTTCCACAGTGCAGAAGG + Intergenic
1060967761 9:127721189-127721211 CCAGGTGTCCCCAGGGCAGGGGG + Intronic
1061009497 9:127946613-127946635 CTAGGCCACCCCAGCGCAGGTGG - Intronic
1061709613 9:132478618-132478640 CGAGGCTTCTCCAAGGCAGATGG + Intronic
1061865035 9:133487790-133487812 CTCGGCTTTTCCAGGGCAGTAGG - Intergenic
1203662497 Un_KI270753v1:58124-58146 CAAAGCTTCCACAGTGCAGAAGG - Intergenic
1203670891 Un_KI270755v1:10687-10709 CAAAGCTTCCACAGTGCAGAAGG + Intergenic
1186542166 X:10411795-10411817 GCAGGCTTACCCAGGGCAAAGGG - Intergenic
1188592927 X:31861820-31861842 CTTGGCTTGGCGAGGGCAGAAGG - Intronic
1191174697 X:57486279-57486301 TAAGGCTTCCTCAGGCCAGAAGG - Intronic
1192606463 X:72524344-72524366 CTGGGCATCCCTAGGGCATAGGG - Intronic
1193858863 X:86639784-86639806 CTGAGCTGACCCAGGGCAGAAGG + Intronic
1197885709 X:131215958-131215980 CTAGTCATCCACAGGACAGATGG + Intergenic