ID: 1101823366

View in Genome Browser
Species Human (GRCh38)
Location 12:108201396-108201418
Sequence GAGGCTAAACTGGAGTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101823366_1101823372 19 Left 1101823366 12:108201396-108201418 CCAGCCTACTCCAGTTTAGCCTC 0: 1
1: 0
2: 3
3: 54
4: 358
Right 1101823372 12:108201438-108201460 CATGACCCTATTTCCAAATAAGG 0: 2
1: 106
2: 581
3: 1362
4: 2234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101823366 Original CRISPR GAGGCTAAACTGGAGTAGGC TGG (reversed) Intronic
901692792 1:10984504-10984526 GAGGTCATACTGGATTAGGCTGG - Intergenic
902812135 1:18894242-18894264 CAGGTTAAAACGGAGTAGGCCGG + Intronic
903351315 1:22718248-22718270 GAGGCTGAATTGGAGTGGGGAGG - Intronic
906200260 1:43955672-43955694 GAGGTTATACTGGAGTAGGATGG - Intronic
906670881 1:47653757-47653779 GAGGCCATAGTGGAGTAGGGTGG - Intergenic
907557735 1:55359320-55359342 GAGGTCATACTGGAGTAGGGTGG + Intergenic
907782076 1:57576386-57576408 GAGGTTATACTGGAGTAGGCTGG + Intronic
909339405 1:74514889-74514911 GAGTTTATACTGGAGTAGGGTGG + Intronic
909491954 1:76235938-76235960 GAGGTCACACTGGAGTAGGATGG - Intronic
911834196 1:102595139-102595161 GAGGTTATACTGGATTAGGGTGG + Intergenic
911944353 1:104087221-104087243 GAGGCCATACTGGAGTAAGGTGG - Intergenic
913356298 1:117926174-117926196 GAAGCAAAACTGCAGTAGGTTGG - Intronic
913998617 1:143673132-143673154 GGGGCAAGACTTGAGTAGGCTGG + Intergenic
916117684 1:161501521-161501543 GAGGCAAAAGTGGAGTAAGGGGG + Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
916875703 1:168966406-168966428 GAGGCTTGACTGGAGTGTGCTGG + Intergenic
917400283 1:174641310-174641332 GAGGCAAAACTGGAATTGACAGG - Intronic
918184042 1:182111609-182111631 GAGGCTCACCTGGAGTTGGGCGG + Intergenic
918623717 1:186634203-186634225 GAGGTCATACTGGAGTAGGGTGG - Intergenic
918970159 1:191404429-191404451 GAGGTCAAACTGCAGTAGGGTGG + Intergenic
921932401 1:220765323-220765345 GAGGCTGCACTGGAGCTGGCTGG + Intronic
922205272 1:223441006-223441028 GAGGCTATACTGGAGTAGGGTGG - Intergenic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
923338912 1:232991580-232991602 GAGGTCATACTGGAGTAGGATGG + Intronic
923448718 1:234096629-234096651 GAGGCAAGACTGGAGAAGGTTGG + Intronic
924796889 1:247299222-247299244 GAGGTTATACTGGAGTCGGTGGG + Exonic
1063372326 10:5529910-5529932 GAGGATAAACAGGAGCCGGCAGG - Intergenic
1066142021 10:32514299-32514321 GAGGTCATACTGGAGTAGGATGG + Intronic
1067231795 10:44417328-44417350 GAGGCCATACTGGAGCAGGGTGG - Intergenic
1067270298 10:44785801-44785823 GAAGCTAGACTGGAGTGGGGAGG + Intergenic
1069368956 10:67723726-67723748 GAGGCTAAGCAGGTGTGGGCAGG - Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072416374 10:95249940-95249962 GAGGCCAAGCAGGAGTGGGCAGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1074689130 10:115988477-115988499 GAGGCTAGAGGGGAGTAGGATGG + Intergenic
1074924826 10:118057388-118057410 GAAGCAGAACAGGAGTAGGCAGG - Intergenic
1075021783 10:118957447-118957469 GAGGTCACACTGGAGTAGGGTGG + Intergenic
1075117677 10:119640569-119640591 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1075393555 10:122111124-122111146 GAGGCTATCCTGGAGTATCCAGG - Intronic
1075528340 10:123204484-123204506 GAGGGTAAATTGGATGAGGCGGG - Intergenic
1075955697 10:126520917-126520939 GAGGTCACACTGGAGTAGGGTGG - Intronic
1077247208 11:1545478-1545500 GAGGCCACACTGGAGTAGGGTGG + Intergenic
1077274325 11:1696567-1696589 GAGGTTGTACTGGAGTAGGGTGG + Intergenic
1077535407 11:3121761-3121783 GGGGCTACACTGGAGTAAGGTGG + Intronic
1078540961 11:12212635-12212657 GAGGTCATACTGGAGTAGGGTGG - Intronic
1079129969 11:17741568-17741590 GAGGATAAACTGGAGCAGCCAGG - Intronic
1079348885 11:19676172-19676194 GAGGCCAGACTGGAGCAGGGAGG - Intronic
1080848044 11:36043558-36043580 GAGGTTGTACTGGAGTAGGGTGG + Intronic
1085452197 11:76641145-76641167 GAGGCTACACTGAAGTAGGGTGG + Intergenic
1086448328 11:86891009-86891031 GTGGCTAACCAGGAGTAAGCAGG + Intronic
1086980268 11:93189040-93189062 GAGGCTTTGCTGGAGTAGGGAGG - Intronic
1087205117 11:95386363-95386385 GAGGATAGACTGGAGGAGGCTGG + Intergenic
1088933135 11:114372359-114372381 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1089051549 11:115550023-115550045 GAGGGAAAACTGGAGGTGGCTGG - Intergenic
1091004432 11:131939865-131939887 GATGCCAAATTGGAGTAGGAGGG + Intronic
1091854915 12:3731722-3731744 GAGGTCATACTGGAGTAGGGCGG + Intronic
1094466784 12:30762111-30762133 GAGGCCATACTGGATTAGGATGG + Intergenic
1095498639 12:42812280-42812302 GTGGCTAAAGTGGAATTGGCTGG + Intergenic
1096415385 12:51408082-51408104 GAGGTCATACTGGAGTAGGGTGG - Intronic
1096630115 12:52921105-52921127 GAGGCTAAGCTGGCCTGGGCTGG - Intronic
1097010840 12:55952624-55952646 GATGACAAACTGGAGAAGGCAGG - Intronic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1098146816 12:67506020-67506042 GAGGGCACACTGGAGTAGGGTGG + Intergenic
1098602366 12:72347065-72347087 GAGGTCATATTGGAGTAGGCTGG - Intronic
1099669027 12:85667307-85667329 GAGGTCATACTGGAGTAGGACGG + Intergenic
1099810882 12:87580650-87580672 GAGGCTATACTGGACTAGCCAGG + Intergenic
1100871546 12:98915139-98915161 GAGGTCACACTGGAGCAGGCTGG + Intronic
1101069040 12:101053682-101053704 GGGTCATAACTGGAGTAGGCTGG - Intronic
1101322134 12:103681930-103681952 GAGGTCATACTGGAGTAGGGTGG - Intronic
1101823366 12:108201396-108201418 GAGGCTAAACTGGAGTAGGCTGG - Intronic
1102217054 12:111169096-111169118 GAGGCCATACTAGAGTAGGGTGG + Intronic
1102903015 12:116653333-116653355 GAGGTGATACTGGAGTAGGTGGG + Intergenic
1102961629 12:117097196-117097218 GAGGTTAGACTAGAGTAGGCAGG - Intronic
1103033985 12:117641595-117641617 GAGGTCATACTGGAGTAGGGCGG - Intronic
1103791655 12:123476496-123476518 GAGGTTATGCTGGAGTAGGGTGG + Intronic
1103895112 12:124267957-124267979 GAGGTTGTACTGGAGTAGGATGG + Intronic
1104081898 12:125436436-125436458 GAGGTTACACTGGAGTTGGGTGG + Intronic
1104698614 12:130883683-130883705 GAGGCCATACTGGAGTAGTGTGG - Intergenic
1104932677 12:132348069-132348091 GAGGCCACACTGGAGTGGGATGG - Intergenic
1105540786 13:21314690-21314712 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1105914771 13:24903304-24903326 GACGTTATACTGGAGTAGGGTGG + Intronic
1105944292 13:25176494-25176516 GAGGTCATACTGGAGTAGGGTGG - Intergenic
1108618948 13:52162269-52162291 GAGGCCACACTGGGGTAGGATGG - Intergenic
1110272191 13:73603518-73603540 GAGGCCATCCTGGAGTAGGGAGG + Intergenic
1111928728 13:94491411-94491433 GAGGTCATACTGGAGTAGGATGG - Intergenic
1111996290 13:95168941-95168963 GAGGTCATACTGGAGTAGGGTGG + Intronic
1112584586 13:100707065-100707087 GAGGCTATACTGGATGAGGGCGG - Intergenic
1112770761 13:102792565-102792587 GAGGTCATACTGGAGTAGGCTGG + Intronic
1112961967 13:105137619-105137641 GAGGCAAAACTAGAATATGCAGG + Intergenic
1112968937 13:105235004-105235026 GAAGTCATACTGGAGTAGGCTGG + Intergenic
1113086908 13:106577965-106577987 GAGGCCATACTTGAGTAGGGGGG + Intergenic
1115233978 14:31190616-31190638 TAGGCCAGACTGGAGTAGGATGG + Intronic
1115469952 14:33758190-33758212 GAGGACAAAGTGGAGTAGGTGGG - Intronic
1117049280 14:51844343-51844365 CAGGGTAAGCTGGACTAGGCTGG + Intronic
1117442802 14:55775628-55775650 GAGGTCATACTGGAGTAGGTAGG - Intergenic
1118412157 14:65492266-65492288 TAGGCTAAACTGAAGTAAGAAGG - Intronic
1118443393 14:65831377-65831399 GAGGCTAAACCGGGGAAGGCTGG + Intergenic
1118965631 14:70581525-70581547 GAGGCCATACTGGAGTAGAGTGG - Intronic
1119046442 14:71321544-71321566 CAGCCTGAGCTGGAGTAGGCAGG + Intronic
1119334241 14:73819166-73819188 TAGGTTACACTGGAGTAGGATGG - Intergenic
1119895592 14:78216972-78216994 GAGGTCATACTGGAGTAGGCCGG - Intergenic
1120112818 14:80577995-80578017 TAGGTTAAACTGGAGTGGGGTGG - Intronic
1120739790 14:88095378-88095400 GAAGCCATACTGGAGTAGGGTGG - Intergenic
1120824839 14:88945696-88945718 GAGGCCAGACTGGGGTAGGGTGG + Intergenic
1120922453 14:89767278-89767300 TCGGCCACACTGGAGTAGGCAGG - Intergenic
1121454474 14:94029571-94029593 GAGGTCATACTGGAGTAGGGTGG - Intronic
1123041412 14:105491742-105491764 GGGGCTTTACAGGAGTAGGCGGG - Intronic
1123063078 14:105603067-105603089 TAGGCTAAACTGGGTTTGGCTGG - Intergenic
1124076149 15:26446239-26446261 GAGGCCATGCTGGAGTAGGCTGG - Intergenic
1124195173 15:27619293-27619315 GAGGGCAAACTGGAGTAGGGGGG - Intergenic
1124432026 15:29616029-29616051 CAGGCTAACCTGGAGCATGCAGG + Intergenic
1127720343 15:61692985-61693007 GAGGCTAAAATGAACAAGGCAGG + Intergenic
1127720561 15:61694883-61694905 GAGGCCATACTGGAGCAGGGTGG + Intergenic
1127909094 15:63401235-63401257 GTGGCTCAACTGGGGTTGGCTGG - Intergenic
1127911564 15:63420296-63420318 GAGGTTATACTGGAGTTGGGTGG + Intergenic
1128232142 15:66042838-66042860 GAGGTCATACTGGAGGAGGCTGG - Intronic
1129458558 15:75688621-75688643 GAGGCCACCCTGGAGGAGGCAGG - Exonic
1129725235 15:77898251-77898273 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1130191541 15:81741020-81741042 GAGACTAAAGGGGAGTAGGTTGG + Intergenic
1130273284 15:82463457-82463479 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1130465635 15:84190828-84190850 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1130487056 15:84403992-84404014 GAGGCCACCCTGGAGGAGGCAGG - Intergenic
1130498630 15:84482708-84482730 GAGGCCACCCTGGAGGAGGCAGG - Intergenic
1130587925 15:85195423-85195445 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1130638955 15:85652908-85652930 GAGGTTATACTGGAGTAGGGTGG - Intronic
1131489328 15:92848983-92849005 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1132196223 15:99916513-99916535 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1133623032 16:7544438-7544460 GAGGTTATACTGGATTAGGGTGG + Intronic
1134008194 16:10832505-10832527 GAGGTCACACTGGAGTAGGGTGG - Intergenic
1134759181 16:16698416-16698438 GAGGTTGTACTGGAGTAGGCTGG + Intergenic
1134986892 16:18660768-18660790 GAGGTTGTACTGGAGTAGGCTGG - Intergenic
1136507693 16:30716024-30716046 GAGGCTAAACAGGAGAACTCAGG - Intronic
1137631332 16:49947895-49947917 GAGGATATACTGGAGTAGGATGG + Intergenic
1137762711 16:50953459-50953481 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1138434854 16:56991943-56991965 GAGGTCATACTGGAGTAGGATGG + Intronic
1138836258 16:60439260-60439282 GAAAATAATCTGGAGTAGGCTGG - Intergenic
1139721525 16:68859792-68859814 GAGGATGAACTGGAGTAGGCAGG + Intronic
1140692120 16:77494565-77494587 GAGGTCATACTGGAGTAGGGTGG - Intergenic
1140916826 16:79501326-79501348 GAGGTTATACTGGATTAGGGAGG - Intergenic
1141027892 16:80565090-80565112 GAGGTCACACTGGAGTAGGGTGG - Intergenic
1141672681 16:85500971-85500993 CAGGCCATACTGGAGTAGGGTGG - Intergenic
1141761973 16:86034446-86034468 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1141870837 16:86784421-86784443 GAGGTCATACTGGAGTAGGGCGG + Intergenic
1142240345 16:88941835-88941857 GAGGCTGAACGGGAGTTGGGGGG + Intronic
1143149509 17:4798883-4798905 GAGGCTGGGCTGGAGGAGGCTGG - Intergenic
1146587794 17:34097521-34097543 GAGGTCACACTGGAGTAGGATGG + Intronic
1146669007 17:34724022-34724044 CAGGCTGAGCTGGAGCAGGCTGG + Intergenic
1147339287 17:39744316-39744338 GATGGTAAACTGGAGGTGGCTGG - Intronic
1150805239 17:68313526-68313548 GAGGTCATACTGGAGTAGGGTGG - Intronic
1150805554 17:68316043-68316065 GAGATGAAGCTGGAGTAGGCAGG - Intronic
1152432354 17:80256016-80256038 GAGGCCATGCTGGAGTAGGGTGG + Intergenic
1152802669 17:82338996-82339018 GAGGCTACGTTGGAGGAGGCTGG + Intergenic
1153605799 18:6830117-6830139 GAGGTCATACTGGAGTAGGGTGG - Intronic
1154367081 18:13721004-13721026 GAGGTCATACTGGAGTAGGCTGG - Intronic
1155162255 18:23205642-23205664 GAGGTTATACTGGAGTAGGACGG + Intronic
1156178262 18:34573139-34573161 GAAGCTAAACAGGAGTTGCCAGG - Intronic
1158201649 18:54948205-54948227 GAGGTCACACTGGAGTAGGGTGG + Intronic
1158401979 18:57129255-57129277 GAGGCAACACTGGTGAAGGCTGG - Intergenic
1158963954 18:62607639-62607661 GAGGTTATACTGGAGTAGGGTGG - Intergenic
1159507093 18:69352396-69352418 GAGGTTATAGTGGAGTAGGGAGG - Intergenic
1160299854 18:77669654-77669676 GAGGTTAGACTTGAGTAGGATGG + Intergenic
1160596640 18:79980027-79980049 GAGGTCATACTGGAGTAGGTGGG + Intronic
1160701503 19:509689-509711 GAGGTCACACTGGAGTAGGGTGG - Intronic
1163352530 19:16787003-16787025 GAGGATAAACTGCAGTTGGAAGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166987275 19:46668544-46668566 GAGGTCATACTGGAGTAGGGTGG - Intergenic
1166991899 19:46697659-46697681 GCGGCTCAGCTTGAGTAGGCGGG - Intronic
1167571846 19:50293366-50293388 GAGGTGAAGCTGGGGTAGGCTGG + Intronic
1168087836 19:54061434-54061456 GAGGTCATACTAGAGTAGGCTGG + Intronic
925139315 2:1539038-1539060 GAGTCTATACTGGGGTAGGGTGG - Intronic
925391512 2:3497726-3497748 GAGGCGAAACTAGAGTCCGCAGG + Exonic
925749806 2:7077821-7077843 GAGGCTAGACTGCAGCATGCTGG + Intergenic
925790036 2:7475348-7475370 GAGGTCATACTGGAGTAGGGTGG + Intergenic
926028239 2:9563409-9563431 GAGGTCATACTGGATTAGGCTGG + Intergenic
926055957 2:9774165-9774187 GAGGCCACTCTGGAGTAGGGTGG - Intergenic
926246572 2:11125992-11126014 GAGGTCATACTGGAGTAGGGTGG + Intergenic
926512737 2:13802760-13802782 GAGGTCAGACTGGAGTAGGATGG + Intergenic
927399659 2:22696323-22696345 GAGGTCATACTGGAGTAGGATGG + Intergenic
927937215 2:27082763-27082785 GAGGCCAAGCTGGTGTAGCCTGG - Exonic
927943479 2:27120356-27120378 GAGGTCATACTGGAGTAGGGTGG + Intergenic
930831804 2:55752082-55752104 GAGGACATACTGGAGTAGGGTGG + Intergenic
933296356 2:80495585-80495607 GAGGTCATACTGGAGTAGGTTGG + Intronic
936093564 2:109515772-109515794 GAGGCAAAAGTGGAGCAGGAGGG + Intergenic
936098598 2:109554412-109554434 GACCCTGAACTGGAGTAAGCAGG - Intronic
937453870 2:122024920-122024942 GAGGCTAAACTGCTGTGGGGGGG + Intergenic
937480131 2:122249838-122249860 GAGGTCATACTGGAGTAGGGTGG + Intergenic
940013579 2:149080324-149080346 GAGGTCATACTGGAGTAGGATGG - Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941298032 2:163764770-163764792 GAGGTCATACTGGAGTAGGGTGG - Intergenic
941855071 2:170222650-170222672 GAGGTCATACTGGAGTAGGGTGG - Intronic
941867049 2:170345758-170345780 GAGGTCATACTGGAGTAGGATGG + Intronic
941874301 2:170417789-170417811 GAGGTCATACTGGAGTAGGGTGG - Intronic
941920991 2:170850548-170850570 GAGGCAAACATGGAGCAGGCAGG + Intronic
943092631 2:183392732-183392754 AAGGTTATACTGGAGTAGGGTGG + Intergenic
943973424 2:194440611-194440633 CAGGCTAGAGTGGAGTAGACTGG + Intergenic
944596858 2:201268882-201268904 GAGGCCATACTGGATTAGGTGGG - Intronic
945831374 2:214790361-214790383 GAAGCGATACTGGAGTAGGGTGG + Intronic
946109744 2:217404128-217404150 GAGACTCAACTGGAGGAGGGAGG - Intronic
947046033 2:225985760-225985782 GCAGCTAAACTGGAGTAAGATGG - Intergenic
947076417 2:226350399-226350421 GGGGCAAAACAGGAGAAGGCAGG + Intergenic
947122454 2:226831418-226831440 GAGGTCACACTGGAGTAGGCTGG + Intergenic
947265392 2:228273962-228273984 GAGGTCATACTGGAGTAGGGTGG - Intergenic
947500453 2:230667407-230667429 GAGGTCATACTGGAGTAGGGTGG - Intergenic
1168805935 20:672348-672370 GAGGCTGAAAGGGAGTAGGAAGG + Intronic
1169475808 20:5930267-5930289 GAGGTCATACTGGAGTAGGATGG - Intergenic
1169633846 20:7665150-7665172 GAGGCTAAAATAGAGCAAGCAGG + Intergenic
1172174613 20:32964723-32964745 GAAGTTATACTGGAGTAGGGCGG - Intergenic
1174855222 20:54038279-54038301 GAGAATAAACAGGAGTAAGCAGG - Intronic
1176378383 21:6098674-6098696 GAGACCATACTGGAGTAGGCTGG + Intergenic
1176990389 21:15489538-15489560 GAGGCTAACCTGGATTAGTTAGG - Intergenic
1179190824 21:39120357-39120379 GAGGTCCTACTGGAGTAGGCTGG - Intergenic
1179245586 21:39631453-39631475 GAGGTCATACTGAAGTAGGCTGG - Intronic
1179537350 21:42061137-42061159 GAGGTCAAATTGGAGTAGGGTGG - Intergenic
1179728298 21:43353292-43353314 GAGGCCATGCTGGAGTAGGCTGG + Intergenic
1179745089 21:43439558-43439580 GAGACCATACTGGAGTAGGCTGG - Intergenic
1179997530 21:44980924-44980946 GAGGCCACACTGGAGCAGGGAGG - Intergenic
1180741912 22:18059388-18059410 GAGGATGAACTGGAGTGGGCAGG + Intergenic
1181583277 22:23839376-23839398 GAGGCAAAACTGGAAAGGGCGGG + Intergenic
1182051677 22:27317155-27317177 GAAGTCACACTGGAGTAGGCTGG + Intergenic
1182097006 22:27632899-27632921 GAGGCTGAGCTGGAGAAGGCTGG + Intergenic
1182357217 22:29727637-29727659 GAGGAGAGAATGGAGTAGGCTGG - Intronic
1182645042 22:31801554-31801576 GAGGCTTAAATGGAGCAGCCAGG + Intronic
1183646454 22:39129886-39129908 GAGGCTAGGCTGGAGCAGGCAGG - Intronic
1183819941 22:40338023-40338045 GAATCTAAACCGGATTAGGCGGG - Intergenic
1184605205 22:45569033-45569055 GAGGTCACACTGGAGTAGGGTGG - Intronic
1184717461 22:46290116-46290138 AAGGCTAAAAGGGAGTGGGCTGG - Intronic
1184843087 22:47063933-47063955 GAGGCCACACTGGAGTAGGGGGG - Intronic
1184843107 22:47064023-47064045 GAGGCCACACTGGAGTAGGGGGG - Intronic
949444040 3:4114665-4114687 GAGGCTAAACTGGAGGTGATGGG + Intronic
950202805 3:11056889-11056911 GAGGCTGGACTGGAGGGGGCGGG - Intergenic
950704505 3:14771594-14771616 GAGGCCATACTGGAGGAGGGTGG - Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
952177062 3:30875807-30875829 GAGGATAAACTGCAATATGCTGG - Intronic
952498076 3:33933674-33933696 GAGGTCATACTGGAGTAGGGTGG + Intergenic
952825064 3:37517812-37517834 GAGGCAAAACTCCAGTGGGCTGG - Intronic
953123131 3:40065293-40065315 GAGGTCATACTGGAGTAGGGTGG - Intronic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
955879830 3:63531513-63531535 GAGGTTATACTCGAGTAGGGTGG - Intronic
956181783 3:66524155-66524177 GAGATTGTACTGGAGTAGGCTGG + Intergenic
956319865 3:67984786-67984808 AAGGCTATACTGGAGTAGAGTGG - Intergenic
956694101 3:71904100-71904122 GAAGTCAGACTGGAGTAGGCTGG + Intergenic
958043771 3:88257942-88257964 GAGGCCATACTGGATTAGGATGG - Intergenic
958799972 3:98744004-98744026 GAGGTCACACTGGAGTAGGGTGG + Intronic
959223255 3:103549291-103549313 GAGGTCACACTGGAGTAGGATGG + Intergenic
959830278 3:110853461-110853483 TAGGCTATACTGGAGTAGAGTGG + Intergenic
960788709 3:121402146-121402168 AAGACTGAACTGGAGTAGTCAGG + Intronic
960995510 3:123337690-123337712 GAGGTCATACTGGAGTAGGATGG - Intronic
961352868 3:126315213-126315235 GAGGTTGCACTGGAGTAGGGTGG - Intergenic
962360113 3:134733532-134733554 GAGGTTATACTGGGGTAGGGTGG + Intronic
962436484 3:135371735-135371757 GAAGCCAGCCTGGAGTAGGCTGG - Intergenic
965410177 3:168320434-168320456 GAGGTTGTACTGGAGTAGGGTGG + Intergenic
969185496 4:5471293-5471315 GAGGTCAGACTGGAGTAGGGTGG + Intronic
969255977 4:6002116-6002138 GAGGCCATACTGGATTAGGCTGG + Intergenic
969694572 4:8727423-8727445 GAGGTCACACTGGAGTAGGGTGG - Intergenic
969704061 4:8782571-8782593 GAGGGGGAACTGGAGTAGGGAGG + Intergenic
970939685 4:21616796-21616818 GAGGCCATACTGAAGTAGGATGG - Intronic
970992238 4:22225664-22225686 GAGGCCATACTGGAGTAGGGTGG + Intergenic
971362056 4:25947190-25947212 GAAGCTATACTGGAATAGGGTGG - Intergenic
971716112 4:30179160-30179182 GAGGTTATACTGGAGTAGTGTGG - Intergenic
972816058 4:42646531-42646553 GAAGCTGAACTGGTGTAGGCTGG + Intronic
975318168 4:72978995-72979017 GAGGATATACTGAAGTAGGGTGG + Intergenic
978214600 4:106183810-106183832 GAGACTAAACTGCAGTAAGTGGG - Intronic
978585644 4:110273241-110273263 GAGGTCATACTGGAGTAGGGTGG - Intergenic
979039947 4:115777003-115777025 GAGGCTACACTGGAGTGGGTTGG + Intergenic
979552824 4:122010179-122010201 GAGGTTGTACTGGAGTAGGGTGG - Intergenic
980249938 4:130301951-130301973 GAGGCTATACTGGAATAGAATGG - Intergenic
980421180 4:132563635-132563657 GAGGCCATACTGGGGTAGGGTGG - Intergenic
981652503 4:147075813-147075835 GAGGTCATACTGGAGTAGGGTGG + Intergenic
981859100 4:149333427-149333449 GAGGTTGCGCTGGAGTAGGCTGG - Intergenic
982260363 4:153488985-153489007 GAGGCTGGACTGGAGTAGGGTGG - Intronic
982363857 4:154553468-154553490 GAAGCCATACTGGAGTAGGGTGG - Intergenic
982685739 4:158486646-158486668 GAGGTCACACTGGAGTAGGGTGG - Intronic
983202348 4:164874518-164874540 GAGGTCATACTGGAGTAGGGTGG - Intergenic
983653316 4:170055082-170055104 GAGGTCATACTGGAGTAGGATGG + Intergenic
983668910 4:170213718-170213740 GAGGTCATACTGGAGTAGGTTGG - Intergenic
983927108 4:173414209-173414231 GAGGCTCCACTGGAGCAGCCTGG + Intergenic
984308628 4:178028159-178028181 GACCCTGAACTGGAGTAAGCAGG + Intergenic
984821844 4:183889229-183889251 GAGGTTGTACTGGAGTAGGGTGG + Intronic
985277698 4:188254559-188254581 GAGGCCATTCTGGAGTAGGATGG - Intergenic
985993526 5:3583501-3583523 GAGGTCACACTGGAGTAGGGTGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986804121 5:11292308-11292330 GAGGTCATACTGGAGTAGGGTGG + Intronic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
986833260 5:11605948-11605970 GAGGCTAACCTGGATTATCCAGG + Intronic
987449436 5:18063552-18063574 GAGGTTATATTGGAGTAGACTGG - Intergenic
987781529 5:22442688-22442710 GAGGATGATCTGAAGTAGGCAGG + Intronic
989718489 5:44494491-44494513 GACCCTAAACTGGAATAAGCAGG - Intergenic
990314363 5:54570087-54570109 GAGGGTATACTGGAATAGGGTGG + Intergenic
990509318 5:56476046-56476068 GAGGTCAAACTGGTGCAGGCTGG - Intronic
990757213 5:59086939-59086961 GAGGTAGAATTGGAGTAGGCAGG - Intronic
991085059 5:62641088-62641110 GAGGTCATACTGGAGTAGGGTGG - Intergenic
991225951 5:64272473-64272495 GAGGTTAGAGTGGAGTAGGAGGG + Intronic
995268996 5:110199612-110199634 GAGGTCATACTGGAGTAGGGTGG + Intergenic
995571279 5:113485242-113485264 CATTCTAAACAGGAGTAGGCTGG - Intronic
995906652 5:117132250-117132272 GAGGCTACACTGGAGTTGGGTGG - Intergenic
996683261 5:126251280-126251302 AAGGTTACACTGGAGTAGGGTGG - Intergenic
996928092 5:128852997-128853019 GAGATTATACTGGAGTAGGGTGG - Intronic
997815068 5:137008867-137008889 GAGGCTAAACTGGGGGAGAAGGG + Intronic
998628587 5:143873706-143873728 GAGGCTTAGGTGGAGTAGGGAGG - Intergenic
1001720313 5:173851765-173851787 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1002575821 5:180173063-180173085 GTGACTTAACTGGAGCAGGCAGG - Intronic
1003016631 6:2473244-2473266 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1003112309 6:3260244-3260266 AAGGTTATACTGGAGTAGGATGG - Intronic
1003399678 6:5781544-5781566 GAGGTCATACTGGAGTAGGCTGG + Intergenic
1003412110 6:5874665-5874687 GAGGCCATACTGGCGTAGGGTGG - Intergenic
1003627617 6:7757495-7757517 GAGGTCATACTGGAGTAGGGTGG - Intronic
1003804741 6:9714302-9714324 GAGGCCATACTGGAGTAGGGTGG - Intronic
1003939175 6:11007321-11007343 GAGGTTATACTGGATTAGGGTGG + Intronic
1003954197 6:11146912-11146934 GAGGTTATACTGGATTAGGGTGG + Intergenic
1004232173 6:13843454-13843476 AAGGTTAAACTGGATTAGGATGG + Intergenic
1005264037 6:24092417-24092439 GAGGTCATACTGGATTAGGCTGG + Intergenic
1005311165 6:24560792-24560814 GAAGTTATACTGGAGTAGGGTGG - Intronic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1007309355 6:40933297-40933319 GAGGCTGAACTGGGATATGCCGG + Intergenic
1008904720 6:56663569-56663591 GAAGCTAAACTGGATTGGACTGG - Intronic
1009482904 6:64182841-64182863 GAGGGTAGACAGGAGTAGGGTGG - Intronic
1009545786 6:65018483-65018505 GAGGATATACTGGAGTAGGTGGG - Intronic
1009883191 6:69595028-69595050 GAGGCCATACTGGAGTAGGATGG - Intergenic
1010977186 6:82329217-82329239 GAGGTCATACTGGAGTAGGACGG + Intergenic
1011777985 6:90753340-90753362 GAGGCTAGTCTGGAGTGGGTTGG + Intergenic
1012630305 6:101458490-101458512 GAGGCTGCACTGCAGGAGGCTGG - Intronic
1012963792 6:105650818-105650840 GAAGCAAAATTGGAGGAGGCAGG + Intergenic
1013635557 6:112026175-112026197 GAGGTAATACTAGAGTAGGCTGG - Intergenic
1013960920 6:115899100-115899122 GAGGCCACACTGGATTAGGGTGG - Intergenic
1014273526 6:119361387-119361409 GAAGCCAGACTGGAGTAGGTTGG - Intergenic
1014723631 6:124949857-124949879 GAGGTCATACTGGAGTAGGATGG + Intergenic
1015159674 6:130138532-130138554 GAGGTCACACTGGAGTAGGGTGG - Intronic
1015800583 6:137058201-137058223 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1016568097 6:145480950-145480972 GAGTCTAAACTGGAGTTGCATGG + Intergenic
1017506717 6:155075096-155075118 GAGAGTAACCTGGAGTAGCCAGG - Intronic
1017815089 6:158010701-158010723 GAGATTATACTGGAGTAGGGTGG + Intronic
1018045790 6:159965328-159965350 GAGGTTATACTAGAGTAGGGTGG - Intergenic
1019213503 6:170424608-170424630 GATGCTGAACTGGAGCAGCCAGG - Intergenic
1019530366 7:1500066-1500088 GAGGCAAAGCTGGGGTGGGCCGG + Intronic
1019560030 7:1651310-1651332 GAGGCTTGATTGGAGCAGGCAGG + Intergenic
1019769657 7:2875791-2875813 GAGGATACACTGGAGTAGGAAGG - Intergenic
1021114241 7:16730549-16730571 GAGGTTATAATGGAGTAGGATGG + Intergenic
1021498959 7:21308107-21308129 GAAGCCATACTGGAGTAGGTTGG - Intergenic
1021621164 7:22552351-22552373 GAGGTCACACTGGAGTAGGGAGG - Intronic
1021689891 7:23221535-23221557 GAGGTCAAACTGGATTAGGGTGG + Intergenic
1024043292 7:45571335-45571357 GAGGCTATATTGGAGTAGTGTGG - Intergenic
1024135183 7:46399610-46399632 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1024561867 7:50651495-50651517 GAGGTCGTACTGGAGTAGGCTGG - Intronic
1025939577 7:66065225-66065247 GAGGTTATACTGGAGTAGGTGGG + Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1029884668 7:103855851-103855873 GAGGTTATACTGGAGTAGGGTGG - Intronic
1030800413 7:113843254-113843276 GAGGCCATACTGGAGTAGAATGG - Intergenic
1030977638 7:116146410-116146432 GAGGCAAAGCTGCAATAGGCAGG - Intronic
1031013385 7:116547120-116547142 GAGGTCATACTGGAGTAGGGTGG - Intronic
1032098669 7:128954545-128954567 GAGCCAAAACTGGGGTGGGCGGG - Exonic
1032464203 7:132133638-132133660 GGGGCTAAATGGGAGGAGGCAGG + Intronic
1032934506 7:136713308-136713330 GAGGTCATACTGGATTAGGCTGG + Intergenic
1033235729 7:139636475-139636497 GAGGTCACACTGGAGTAGGTGGG + Intronic
1034203867 7:149299171-149299193 GAGGTCACACTGGAGTAGGATGG + Intergenic
1034553391 7:151835059-151835081 GAGGCCACATTGGAGCAGGCTGG - Intronic
1034672426 7:152868792-152868814 GAGGTCACACTGGAGTAGGGTGG - Intergenic
1034890511 7:154835172-154835194 GAGGCCATACTGGAGTAGGATGG + Intronic
1035366654 7:158352642-158352664 GAGGCGTAATTGGGGTAGGCTGG + Intronic
1036196705 8:6723455-6723477 GAGGCTGAGGTGGAGTGGGCGGG - Intronic
1039596012 8:38790275-38790297 GAGGTCAAACTGGATTAGGGTGG - Intronic
1040592402 8:48805592-48805614 GAGGACACACTGGAGTGGGCTGG + Intergenic
1041136319 8:54762968-54762990 GAGGCCATACTGGAGTAGGATGG - Intergenic
1041260660 8:56018488-56018510 GAGGTCACACTGGAGTAGGCTGG + Intergenic
1041459997 8:58100712-58100734 GAGGTCATTCTGGAGTAGGCTGG - Intronic
1042175692 8:66035404-66035426 GAGGCCTTACTGGAGTAGGGTGG + Intronic
1043425700 8:80146449-80146471 GAGGCTAACCTGGAGTTGCTAGG - Intronic
1043509379 8:80934321-80934343 GAGCTTAAACTGGAATAGGGTGG - Intergenic
1044474472 8:92609778-92609800 GAGGCCAGACTGGATTAGGTGGG - Intergenic
1045312965 8:101019308-101019330 AAGGGTGAACTGGAGTGGGCTGG - Intergenic
1045597741 8:103675413-103675435 GAGGCAAAACTGGACCAGGGAGG + Intronic
1046066486 8:109202930-109202952 GAGGCTCCACTGCAGTGGGCAGG + Intergenic
1046645600 8:116782434-116782456 GAGGTCACACTGGAGTAGGATGG - Intronic
1048367814 8:133753687-133753709 GAGGCCATACTGGATTAGGGTGG - Intergenic
1049242077 8:141543174-141543196 GAGGCCATACTGGAGTAGGGTGG + Intergenic
1049673944 8:143881443-143881465 GAGGTCATGCTGGAGTAGGCGGG + Intergenic
1050047000 9:1557309-1557331 GAGGTTATACTGGAGTAGGTAGG + Intergenic
1051682273 9:19619461-19619483 GAAGCTAAACAAGAGGAGGCTGG + Intronic
1053606673 9:39666952-39666974 GATGCCAAACTGCAGGAGGCTGG + Intergenic
1053864592 9:42423579-42423601 GATGCCAAACTGCAGGAGGCTGG + Intergenic
1054246862 9:62675452-62675474 GATGCCAAACTGCAGGAGGCTGG - Intergenic
1054560983 9:66709986-66710008 GATGCCAAACTGCAGGAGGCTGG - Intergenic
1054979353 9:71186177-71186199 GAGGCCATACTGGAGCAGGATGG - Intronic
1055319896 9:75073099-75073121 GAGGTCACACTGGAGTAGGGTGG + Intronic
1055666834 9:78561341-78561363 GAGGTCATACTGGAGTAGGGTGG - Intergenic
1056789427 9:89616129-89616151 GAGCCTAAGCAGGAGTAGGATGG + Intergenic
1056805381 9:89724855-89724877 GAGGTCATACTGGAGTAGGGAGG + Intergenic
1057282650 9:93723912-93723934 GAGGTCATACTGGATTAGGCTGG - Intergenic
1057395983 9:94680805-94680827 GAGGTTATACTGGAGGAGGGAGG + Intergenic
1057491993 9:95527627-95527649 GAGGTCACACTGGAGTAGGTGGG - Intergenic
1058680258 9:107434513-107434535 GAGGTGATACTGGAGTAGGGTGG - Intergenic
1059180550 9:112208672-112208694 CAGGTTAAACTGTAGAAGGCTGG - Intergenic
1060310243 9:122453104-122453126 AAGGCAAAGCTGGAGCAGGCAGG - Intergenic
1062037422 9:134388997-134389019 GAGGCCACCCTGGAGGAGGCAGG - Intronic
1185484892 X:474753-474775 GAGGTCATCCTGGAGTAGGCTGG - Intergenic
1185523852 X:761716-761738 GAGGTTATCCTGGATTAGGCTGG - Intergenic
1186495146 X:10007107-10007129 GAGGTCATACTGGAGTAGGGTGG - Intergenic
1186865609 X:13717889-13717911 GAGGTCACACTGGAGTAGGGTGG + Intronic
1186902200 X:14068691-14068713 GAGGTTATACTGGAGTAGGATGG - Intergenic
1186970067 X:14832379-14832401 GAGGTCATACTGGAGTAGGGTGG - Intergenic
1187186486 X:16991628-16991650 GAGGTTATACCGGAGTAGGGTGG + Intronic
1187824503 X:23321132-23321154 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1188293695 X:28419058-28419080 AAGGTTATACTGGAGTAGGGTGG + Intergenic
1192826941 X:74707143-74707165 GAGGTTATATTGGAGTACGCTGG + Intergenic
1193182668 X:78477111-78477133 GAGGTTAAAATGGAGTAGGATGG - Intergenic
1193607173 X:83583269-83583291 GAGGTCATACTGGGGTAGGCTGG - Intergenic
1195945595 X:110207327-110207349 AAGGCTAAGCTGGAGTAGTAGGG - Intronic
1196190648 X:112790868-112790890 GAGTCGAAACAGAAGTAGGCTGG - Intronic
1196701128 X:118669981-118670003 GAAGCAATACTGGAGTAGGGTGG - Intronic
1197821182 X:130542396-130542418 GAGGCCATACTGGAGTAGGGTGG - Intergenic
1198325933 X:135573242-135573264 GAGATGAAGCTGGAGTAGGCAGG + Intronic
1199104858 X:143853477-143853499 GAGGTCATACTGGAGTAGGGTGG + Intergenic
1199697746 X:150355139-150355161 GTGGTTATACTGGAGTAGGATGG + Intergenic
1199768282 X:150956576-150956598 GAGGTCATACTGGAGTAGGAGGG + Intergenic
1199981282 X:152921878-152921900 GAGGTCATACTGGAGTAGGATGG - Intronic
1200244139 X:154513919-154513941 CAGGCCAGACTGGAGTAGGGTGG - Intronic