ID: 1101825888

View in Genome Browser
Species Human (GRCh38)
Location 12:108219710-108219732
Sequence CAGCTCTTATCCTGTAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101825888_1101825895 0 Left 1101825888 12:108219710-108219732 CCCACATTACAGGATAAGAGCTG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1101825895 12:108219733-108219755 GTGGGCTTGGGATCCCTGCAAGG 0: 1
1: 0
2: 0
3: 14
4: 200
1101825888_1101825900 22 Left 1101825888 12:108219710-108219732 CCCACATTACAGGATAAGAGCTG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1101825900 12:108219755-108219777 GGTACCCAGGACAACCCCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 119
1101825888_1101825897 9 Left 1101825888 12:108219710-108219732 CCCACATTACAGGATAAGAGCTG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1101825897 12:108219742-108219764 GGATCCCTGCAAGGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 84
1101825888_1101825896 1 Left 1101825888 12:108219710-108219732 CCCACATTACAGGATAAGAGCTG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1101825896 12:108219734-108219756 TGGGCTTGGGATCCCTGCAAGGG 0: 1
1: 0
2: 2
3: 19
4: 142
1101825888_1101825902 24 Left 1101825888 12:108219710-108219732 CCCACATTACAGGATAAGAGCTG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1101825888_1101825901 23 Left 1101825888 12:108219710-108219732 CCCACATTACAGGATAAGAGCTG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1101825901 12:108219756-108219778 GTACCCAGGACAACCCCAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101825888 Original CRISPR CAGCTCTTATCCTGTAATGT GGG (reversed) Intronic
901285760 1:8077369-8077391 CAGCTCTTGACCAGTACTGTAGG - Intergenic
908302734 1:62778335-62778357 CAGCTCTTACACTGAAAGGTGGG - Intergenic
909356208 1:74712954-74712976 CAGCTATTATCCAGATATGTTGG - Intronic
911882133 1:103253226-103253248 CAACTCTTATCATGTAAGGATGG - Intergenic
911932868 1:103927177-103927199 AAGCCTTTATCCTGTAATGCAGG - Intergenic
913999118 1:143677713-143677735 CAGCTCTAATGCTTTAATGGTGG + Intergenic
918267798 1:182862529-182862551 CCGTTCTTATCCTGAAATGATGG - Intronic
918445356 1:184611767-184611789 CAGCCTTTATCCTGTACTGTGGG - Intronic
919983922 1:202659702-202659724 CTGCCCTTCTCCTCTAATGTTGG + Intronic
920196595 1:204231533-204231555 CAGTTGTTATCCTGTATTGTTGG + Intronic
923728292 1:236526272-236526294 CAGCTCTTGTCCTCTAGTGGAGG + Intronic
924643302 1:245854103-245854125 CAAATCTTACCCTATAATGTGGG + Intronic
1067717658 10:48701918-48701940 CAGCTTTTATCCTGTACAGTGGG - Intronic
1069566479 10:69466693-69466715 CAGCTCTTTTCTGGGAATGTAGG + Intronic
1072321624 10:94255806-94255828 CATCTCTTAAACTTTAATGTGGG - Intronic
1075230383 10:120671415-120671437 CAGTTCTTATCCAGTGATGGAGG + Intergenic
1078208430 11:9250426-9250448 CAGCTCCTCTACTGCAATGTGGG + Intronic
1078460705 11:11513224-11513246 CAGTTCTTCTTCTGTAATATGGG + Intronic
1083768066 11:64851650-64851672 CAGCATTTAACCTTTAATGTGGG + Exonic
1084901512 11:72313508-72313530 CAGCTCTTTTTCTGTAAGGTTGG - Intronic
1085526757 11:77168483-77168505 CAGTTCTTCACCTGTAAAGTGGG - Intronic
1086226208 11:84513050-84513072 CACCTGTTAACCTGTAATCTAGG - Intronic
1087131680 11:94674164-94674186 CTGCTCTTATCCTGGTAGGTGGG - Intergenic
1087317462 11:96619923-96619945 CAGGTACTATCCTGTAAAGTTGG - Intergenic
1093425105 12:19019621-19019643 CAGCTCTTTTCCTGTCATCCAGG - Intergenic
1093620437 12:21282505-21282527 AAGCCCTTATTCTGTAATCTGGG + Intronic
1101825888 12:108219710-108219732 CAGCTCTTATCCTGTAATGTGGG - Intronic
1101952276 12:109186330-109186352 AGGCTCTTTGCCTGTAATGTGGG - Intronic
1102720149 12:115008816-115008838 AAGCTCTCATTCTGTAATGAGGG - Intergenic
1105882661 13:24617617-24617639 CACCTTTTAACCTATAATGTAGG - Intergenic
1113892142 13:113742089-113742111 CAGCTCTTGTCCTGTCACGTGGG + Intergenic
1116373365 14:44165073-44165095 CATTACTTATCCTGTAATGATGG - Intergenic
1117574604 14:57085502-57085524 TACCTCTTATCCTGTAAAATGGG + Intergenic
1117966707 14:61213879-61213901 CAGCTATTATGCTATAATCTGGG + Intronic
1118466703 14:66037912-66037934 CAGCTGCCATCCTGTATTGTCGG + Intergenic
1120459488 14:84776457-84776479 CTTCTTTTATCCAGTAATGTAGG + Intergenic
1120883372 14:89432513-89432535 CAGCACCTATCCTGTAAGGGTGG - Intronic
1123844461 15:24283983-24284005 TCTCTCTTATACTGTAATGTTGG - Intergenic
1125612450 15:40980747-40980769 CAGCTCTCATCCTGTAACTTTGG - Intronic
1127824101 15:62688473-62688495 CTGCTATTATCATGTAAAGTGGG + Intronic
1135790986 16:25395683-25395705 CAGCTTTGCTCCTGTAATTTAGG + Intergenic
1136026809 16:27473971-27473993 GCGCTCCTATCCTGTTATGTGGG - Intronic
1138213616 16:55183852-55183874 CACCTCTTATTCTGTTATGTTGG + Intergenic
1138888205 16:61107019-61107041 CAGCTCTGAACCTGTAGTCTTGG - Intergenic
1141176935 16:81726980-81727002 CAGCTCTTCTCATGGAATGAGGG + Intergenic
1142647612 17:1325069-1325091 CAGCTATTATCATAGAATGTTGG + Intergenic
1146481163 17:33206118-33206140 TAGCTCTTCTCCTGTCATCTAGG - Intronic
1155374495 18:25140823-25140845 CAGCGATTATTCTGTAATCTTGG - Intronic
1164451154 19:28366167-28366189 CAGAACTTATCCTCTTATGTTGG - Intergenic
1166214118 19:41324713-41324735 CAGCTCTCATCCTGCACTCTTGG - Exonic
925220022 2:2131603-2131625 CAGACTTTAGCCTGTAATGTGGG + Intronic
929366875 2:41169572-41169594 CAGCTCTAAGCCTGCAATGAAGG - Intergenic
930901119 2:56508831-56508853 CAGCTCCTAACCTGGAGTGTTGG - Intergenic
934551768 2:95267202-95267224 CAGCTCTTATCCTGTAGGGCAGG - Intergenic
934637425 2:96003123-96003145 CAGCACTAATCCAGTAATGAGGG - Intergenic
941550031 2:166903670-166903692 CATCTCTTCCCCTGTACTGTAGG - Exonic
941655501 2:168139839-168139861 CTGCTCTTATAGTGTAATGTTGG - Intronic
943012693 2:182470257-182470279 CAGCTTTTATTATGAAATGTTGG - Intronic
944300103 2:198114130-198114152 CAGCTCTTATCCAACAATATAGG + Intronic
944593603 2:201241001-201241023 CTGCTTTTATCCTGTAAGTTTGG - Intronic
946941509 2:224774550-224774572 CAGCTCTTATCGTGTGCTTTGGG - Intronic
1169623404 20:7534493-7534515 CAGATCTTATCCAGCAATGTTGG - Intergenic
1175043446 20:56078459-56078481 CAGCATTTATCCTTTAAGGTTGG - Intergenic
949950673 3:9226191-9226213 CAGTTCTTACCAAGTAATGTGGG - Intronic
953772919 3:45792576-45792598 CAGCTGTTTACCTGTAAAGTGGG - Intronic
956973242 3:74551195-74551217 CACCTCTTTTGCTGTAAAGTAGG - Intergenic
960650501 3:119943082-119943104 CAGCTTTTATCCTGTAACAGGGG - Intronic
961195830 3:125000648-125000670 CAGCTCTTATCCCAGAATGAAGG + Intronic
962311713 3:134331525-134331547 CATCCCTGATCCTGGAATGTGGG + Intergenic
962543647 3:136409595-136409617 CAGCTGTAATCCTGTCATTTTGG - Intronic
964786663 3:160402673-160402695 CAGCGCTTTTCCTGTATTATCGG + Exonic
968427564 4:533796-533818 CAGCTCTTCTCCTGTATTCCAGG + Exonic
971525469 4:27612206-27612228 TTGCTCTTATTCTGTAATGTAGG + Intergenic
971742122 4:30534451-30534473 CATCTCTTATTCTTGAATGTGGG - Intergenic
972391818 4:38621171-38621193 CAGAGCTTATCTTGTAATGCTGG - Intergenic
973828719 4:54736725-54736747 CAGCCCCTATCCTGGAATGCCGG + Exonic
974169859 4:58252198-58252220 CAGCTCTTACCTTGTAGTGGAGG + Intergenic
976810039 4:89090463-89090485 CTGCTCTTATTCAGTCATGTTGG + Intronic
977727888 4:100318909-100318931 CAGTTTTTCACCTGTAATGTGGG + Intergenic
978553008 4:109948355-109948377 GAGCTCTTTACCTGTGATGTAGG + Intronic
980765024 4:137290804-137290826 CAGTTCTTATCCTTTCATTTCGG - Intergenic
980880402 4:138704389-138704411 CAGTTCTTACTCTGTAAAGTGGG - Intergenic
983480210 4:168264399-168264421 CACCTATTATTTTGTAATGTTGG + Intronic
984576025 4:181449240-181449262 CAGTTTTTCTCCTGTCATGTAGG + Intergenic
985042330 4:185904220-185904242 CTGCTCTTATACTGTAAGGGTGG - Intronic
989192667 5:38686450-38686472 CATCTCTTCTCCTGAATTGTTGG + Intergenic
990747783 5:58978683-58978705 CAGCTCTGCTCCTGTAGTTTGGG - Intronic
992041074 5:72833384-72833406 CCCCTCTTAATCTGTAATGTTGG + Intronic
994562862 5:101398484-101398506 GAGCACTTATCCTCTTATGTAGG + Intergenic
998786355 5:145714036-145714058 CAGTTCTTGTCCTAAAATGTTGG - Intronic
1000919643 5:167122776-167122798 CAGCTTTCATCCTGAAAGGTGGG + Intergenic
1003701489 6:8470173-8470195 CAAATCTTATCGTGTAATGCTGG - Intergenic
1006373008 6:33656941-33656963 CAGCTCTCTTCCTGGAATGGGGG + Intronic
1011165518 6:84441711-84441733 AAGCTCCTATCCTGTAATCTGGG + Intergenic
1012603829 6:101132365-101132387 AAGCTCATATCCTCAAATGTTGG - Intergenic
1012828142 6:104171964-104171986 CTTCTCTCATCCTGTAATATAGG - Intergenic
1014811102 6:125886533-125886555 CTGCTCTTTTCCTGTAATCATGG - Intronic
1022250127 7:28598995-28599017 CAGCTCTCATCCTGTTTTGCTGG + Intronic
1023608774 7:41954054-41954076 CAGCTCTTCTCCAGTAACCTGGG + Intergenic
1025586010 7:62788466-62788488 CAGCTTTTATCCTGGGATATTGG - Intergenic
1027795103 7:82682877-82682899 CAGCTCTTATCTTTAAATGCTGG + Intergenic
1031941309 7:127792555-127792577 CAGCTCCTACCCTCTAAGGTTGG + Intronic
1032268861 7:130386135-130386157 CAGCTCTTGTCCTCTTGTGTTGG + Intronic
1037561400 8:20078041-20078063 CAGCTCTGATGCTGACATGTTGG - Intergenic
1040841816 8:51792686-51792708 CAGCCATTATCCTGTGCTGTGGG - Intronic
1041187761 8:55318814-55318836 CAACTCTTTTCCTGCAAAGTTGG - Intronic
1042147867 8:65750975-65750997 CATTTCTTATCCTGTTATGTAGG - Intronic
1044897249 8:96905486-96905508 CAGCTGTAATGCTATAATGTGGG - Intronic
1045438282 8:102186016-102186038 CAGCTCTTTCTCTGTTATGTGGG + Intergenic
1047192760 8:122693239-122693261 TAGCTATTATGCTGGAATGTAGG + Intergenic
1051553694 9:18359063-18359085 ATGCTCTTATCCAGTAATTTAGG + Intergenic
1051600695 9:18870231-18870253 CAGCTCTTTTGCTGAAATATTGG + Intronic
1053548383 9:39047925-39047947 CAGATTTGATCCTGTCATGTTGG - Intergenic
1055625258 9:78169951-78169973 AAGCTCTCATACTGTAATGCAGG + Intergenic
1056290443 9:85137932-85137954 CAGCTCTTATCCTGGGATAATGG + Intergenic
1058506655 9:105673457-105673479 CAACTCTTTTTCTGTGATGTGGG + Intergenic
1060656711 9:125376981-125377003 CACCATTTATCCTGTAATGGTGG - Intergenic
1060705865 9:125800386-125800408 GAGTTCTTACACTGTAATGTTGG + Intronic
1060918093 9:127403160-127403182 TAGCTCTTCACCTGTGATGTGGG + Intronic
1191766710 X:64705818-64705840 CAGCTGCTTTGCTGTAATGTGGG + Intergenic
1194240823 X:91445122-91445144 CACCTCTAATCCTCTAATGTAGG + Intergenic