ID: 1101825889

View in Genome Browser
Species Human (GRCh38)
Location 12:108219711-108219733
Sequence CCAGCTCTTATCCTGTAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101825889_1101825901 22 Left 1101825889 12:108219711-108219733 CCACATTACAGGATAAGAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1101825901 12:108219756-108219778 GTACCCAGGACAACCCCAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 111
1101825889_1101825897 8 Left 1101825889 12:108219711-108219733 CCACATTACAGGATAAGAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1101825897 12:108219742-108219764 GGATCCCTGCAAGGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 84
1101825889_1101825895 -1 Left 1101825889 12:108219711-108219733 CCACATTACAGGATAAGAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1101825895 12:108219733-108219755 GTGGGCTTGGGATCCCTGCAAGG 0: 1
1: 0
2: 0
3: 14
4: 200
1101825889_1101825900 21 Left 1101825889 12:108219711-108219733 CCACATTACAGGATAAGAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1101825900 12:108219755-108219777 GGTACCCAGGACAACCCCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 119
1101825889_1101825902 23 Left 1101825889 12:108219711-108219733 CCACATTACAGGATAAGAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1101825889_1101825896 0 Left 1101825889 12:108219711-108219733 CCACATTACAGGATAAGAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1101825896 12:108219734-108219756 TGGGCTTGGGATCCCTGCAAGGG 0: 1
1: 0
2: 2
3: 19
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101825889 Original CRISPR CCAGCTCTTATCCTGTAATG TGG (reversed) Intronic
903862764 1:26374807-26374829 CCAGCTCTTGTCCCCTAATGTGG - Intergenic
908302735 1:62778336-62778358 CCAGCTCTTACACTGAAAGGTGG - Intergenic
908995456 1:70147232-70147254 TCAGCTCTTATACTGTAAACGGG + Intronic
909928091 1:81462253-81462275 CCAGCTCTTATTCTCTTATTTGG - Intronic
910036529 1:82795798-82795820 CCAGCTCTTATGCAGAAAAGTGG - Intergenic
913318528 1:117573260-117573282 CCAGCTCTCATAGTGTAGTGTGG - Intergenic
914167190 1:145185710-145185732 CCAACTCCTGTACTGTAATGAGG + Intergenic
917261634 1:173175737-173175759 CCAGCACTTCTTATGTAATGGGG + Intergenic
918445357 1:184611768-184611790 ACAGCCTTTATCCTGTACTGTGG - Intronic
919749262 1:201026350-201026372 CCAGCTCTTGTCCTGAGCTGAGG + Intergenic
919853421 1:201689440-201689462 CCAGCTCCTTTCCTTCAATGAGG + Intronic
919865356 1:201778129-201778151 CAAGCTCTTTTCCTGCAGTGAGG - Intronic
919938349 1:202269704-202269726 CCATGTCTTCTCATGTAATGTGG + Intronic
921046305 1:211480186-211480208 CCAGCTCTGATTCTGTACTGTGG - Intronic
921906848 1:220504488-220504510 CCAGCTGCTATCCTGGGATGAGG - Intergenic
1067717659 10:48701919-48701941 TCAGCTTTTATCCTGTACAGTGG - Intronic
1067900398 10:50234667-50234689 CCAGCTTTTATCCCGTAATGTGG - Intronic
1068419231 10:56767947-56767969 TCAGATCTTTTCCTTTAATGGGG - Intergenic
1070164345 10:73886617-73886639 CCAGCTCTTATGATCTAATGAGG + Intergenic
1070650406 10:78231347-78231369 CCAGCTCTTTTCCTTCAAGGCGG + Intergenic
1071318384 10:84426382-84426404 TCAGATCTTATTTTGTAATGAGG + Intronic
1071564667 10:86665536-86665558 CCAGCTCTTACTCTGGGATGTGG + Intronic
1073206683 10:101773130-101773152 CCAGCTCCTATCCTGCTGTGGGG + Intronic
1073563694 10:104518020-104518042 CCAGCTCTGCTCCTGCAGTGTGG - Intergenic
1075547222 10:123364088-123364110 ACAGGCCTTACCCTGTAATGGGG - Intergenic
1079337146 11:19579933-19579955 CCAGCTATGATCCTGGCATGGGG + Intronic
1081033079 11:38111333-38111355 CCAGCTTTTATTCTGTTATTTGG - Intergenic
1081215086 11:40386417-40386439 TCTGCTCTTTTTCTGTAATGAGG + Intronic
1085526758 11:77168484-77168506 CCAGTTCTTCACCTGTAAAGTGG - Intronic
1088135729 11:106553190-106553212 CCCTCTCTTTTCCTGAAATGTGG - Intergenic
1088540731 11:110911146-110911168 CCAGACCTCATCCTCTAATGGGG + Intergenic
1089183835 11:116601443-116601465 CAAGCCCTTTTACTGTAATGTGG + Intergenic
1089788837 11:120927759-120927781 CCAGCTCTTGTTATGTAAAGAGG + Intronic
1089804964 11:121078418-121078440 CCAGCTCTTATAATGGAATTTGG + Intronic
1092166543 12:6346189-6346211 CCAGGTCTTATGCTGGAGTGGGG + Intergenic
1098043747 12:66379075-66379097 CCAGCTCTTGCCCTGTTGTGTGG + Intronic
1100670722 12:96809733-96809755 TCTGCAGTTATCCTGTAATGAGG - Intronic
1101825889 12:108219711-108219733 CCAGCTCTTATCCTGTAATGTGG - Intronic
1101952277 12:109186331-109186353 CAGGCTCTTTGCCTGTAATGTGG - Intronic
1102422068 12:112811551-112811573 TCAGCTGTTATGCTGTAATCAGG - Intronic
1102720150 12:115008817-115008839 GAAGCTCTCATTCTGTAATGAGG - Intergenic
1106390043 13:29326240-29326262 CCAGCTCTTAAACTGCAGTGGGG - Intronic
1107638700 13:42419231-42419253 GAAGCTCTTGTCCTGTAAGGGGG - Intergenic
1110810735 13:79808409-79808431 CCATCTCTTCTCCTGCAATGTGG - Intergenic
1113023822 13:105918866-105918888 CCACATCCAATCCTGTAATGAGG + Intergenic
1113892141 13:113742088-113742110 TCAGCTCTTGTCCTGTCACGTGG + Intergenic
1117743301 14:58841619-58841641 CCAGCTCTTATCAGCTACTGAGG + Intergenic
1117966706 14:61213878-61213900 CCAGCTATTATGCTATAATCTGG + Intronic
1121287845 14:92750348-92750370 CCAGCTCTTATACTCTTATTTGG - Intergenic
1124111936 15:26798595-26798617 CAAACTCGTATCATGTAATGGGG + Intronic
1129045334 15:72728988-72729010 CCAGCTCATTTCCTGCAAAGAGG + Intronic
1131045354 15:89310658-89310680 CCAGCTCTTAACTAGAAATGGGG + Intronic
1133596327 16:7296988-7297010 CCAGCTCTTCCCCTGACATGAGG - Intronic
1134023357 16:10937175-10937197 CCAGCTCTGCTCCTGACATGAGG - Intronic
1137445727 16:48531003-48531025 CCAGCTCTCATCCTGATATGGGG + Intergenic
1138118550 16:54379790-54379812 CCAGCTCTTAGCCTCTCATTGGG - Intergenic
1138878359 16:60979848-60979870 CCTTCTCTTCTCCTGTATTGTGG - Intergenic
1141176934 16:81726979-81727001 GCAGCTCTTCTCATGGAATGAGG + Intergenic
1142916708 17:3146537-3146559 CCAGCTCTCATCCTATGATACGG - Intergenic
1143405372 17:6674076-6674098 CCAGCTGTGATGCTGGAATGTGG + Intergenic
1154272431 18:12931708-12931730 CAAGTTCTTATGTTGTAATGGGG - Intergenic
1159161575 18:64648652-64648674 CCAGCTTTTATTCTGTTATTTGG + Intergenic
1163242115 19:16070626-16070648 TCACCTCTAATCCTGTCATGGGG - Intronic
931004729 2:57835582-57835604 CCAGTTCCTTGCCTGTAATGAGG + Intergenic
932960200 2:76404722-76404744 TCAGATCTTTTCCTTTAATGAGG + Intergenic
934637426 2:96003124-96003146 ACAGCACTAATCCAGTAATGAGG - Intergenic
934883639 2:98005710-98005732 CCTGCTCTTGTCCTCTAAAGAGG + Intergenic
937742074 2:125367016-125367038 CCAAATCTTATCCTGAATTGTGG + Intergenic
941389689 2:164896376-164896398 CCATCTCTTATCTTGTACTTTGG - Intronic
944906253 2:204264916-204264938 ACAGCTGTTGTCCTCTAATGAGG + Intergenic
946056152 2:216903675-216903697 CCAAATCTTATGTTGTAATGTGG - Intergenic
947484176 2:230532363-230532385 TCAGATCTTTTCCTTTAATGAGG + Intronic
948983543 2:241507299-241507321 CGAGCCCTTAGCCTGGAATGAGG - Intronic
1169819397 20:9691917-9691939 ACAGCCCTTATCTTGAAATGGGG + Intronic
1172490398 20:35332077-35332099 ACAGTTCTTTTCCTGTCATGTGG - Intronic
1172503888 20:35446810-35446832 CCAGCTCCTAACCTGTAGGGTGG - Intronic
1178467019 21:32858304-32858326 CCATCTCTTCACCTGTAATGTGG + Intergenic
1179049579 21:37877514-37877536 CCAGCTCTTTTCCTTTTATTTGG - Intronic
1179621487 21:42619268-42619290 CCAGCACTTTTCCTGTGGTGAGG + Intergenic
1181579130 22:23817285-23817307 CCACCTCTTCACCTGTAATATGG - Intronic
1181837635 22:25623975-25623997 CCAGCTCTTTTCCTGTTATCCGG + Intronic
1184613537 22:45622194-45622216 CCCGCTCTGATCTTGGAATGGGG + Intergenic
949950674 3:9226192-9226214 CCAGTTCTTACCAAGTAATGTGG - Intronic
950204620 3:11069420-11069442 TCAGATCTTTTCCTTTAATGAGG + Intergenic
951632835 3:24739947-24739969 CCAGCTGCTACCCTGTCATGGGG - Intergenic
955830057 3:62991762-62991784 CCACCTCTTTTTCTTTAATGGGG + Intergenic
956528850 3:70194643-70194665 CCAGGTCTTATGTGGTAATGTGG - Intergenic
960650502 3:119943083-119943105 TCAGCTTTTATCCTGTAACAGGG - Intronic
962311712 3:134331524-134331546 CCATCCCTGATCCTGGAATGTGG + Intergenic
964103943 3:153019627-153019649 CCAGCCCTTATCCTTTCTTGTGG - Intergenic
966913076 3:184569881-184569903 CCAGCTCTGAAGCTGGAATGGGG - Intronic
968425121 4:518125-518147 CCAGCTCTCACCCTGTGAGGTGG + Intronic
972639609 4:40913695-40913717 TCAGTTCTTATACTGTAAAGAGG + Intronic
983251341 4:165349957-165349979 CAAGCACTTATCATGAAATGAGG + Intergenic
987080617 5:14422079-14422101 ACAGCTCTTATACTGAAAAGAGG - Intronic
989265225 5:39465344-39465366 CCTGATCTTATCATGTAAAGTGG + Intergenic
996447543 5:123573107-123573129 CCAGCTTTTGTCCAGTAATAAGG + Intronic
997593637 5:135091703-135091725 TCAGCACTTATTCTGTTATGGGG - Intronic
998231240 5:140362713-140362735 CCAGCACTCATCCAGTAATGGGG - Intronic
1001667003 5:173441537-173441559 CCAGCAGGTATCCTGTGATGTGG - Intergenic
1004064580 6:12230616-12230638 TCAGCCCTTATCCTGTAAACAGG - Intergenic
1006373007 6:33656940-33656962 TCAGCTCTCTTCCTGGAATGGGG + Intronic
1011165517 6:84441710-84441732 TAAGCTCCTATCCTGTAATCTGG + Intergenic
1012564724 6:100633946-100633968 CAAGCACTTATCGTGTACTGTGG - Intronic
1016132837 6:140497996-140498018 ACAGCTCTTGGCCTGTAATTGGG - Intergenic
1018244265 6:161806637-161806659 CCAGCTCTTATTCTGTAGGACGG + Intronic
1019213992 6:170429545-170429567 CCAGCTCTAATTCTGTTGTGAGG - Intergenic
1020982001 7:15081829-15081851 CCAGCTCTTATTCTTTCGTGAGG - Intergenic
1021256576 7:18399788-18399810 CCAGCTTCTTTCCTGGAATGTGG - Intronic
1024943538 7:54785998-54786020 GCAGCTTTTATCCTGCAACGCGG + Intergenic
1026772348 7:73210601-73210623 CCAGCACTTAGAGTGTAATGTGG - Intergenic
1027013216 7:74764000-74764022 CCAGCACTTAGAGTGTAATGTGG - Intergenic
1027074824 7:75182034-75182056 CCAGCACTTAGAGTGTAATGTGG + Intergenic
1028274322 7:88833986-88834008 AAAGCTCTTATCCAGAAATGGGG + Intronic
1029575583 7:101401372-101401394 CCAGCTCTAATCCTGCCAGGAGG + Intronic
1035038873 7:155913301-155913323 CCAGCTCTTAGCATCTGATGGGG + Intergenic
1035446230 7:158944988-158945010 CCAGCTCTAATCCTCTCCTGAGG - Intronic
1037276155 8:17181283-17181305 CCAGTTCTTGTGCTTTAATGAGG + Intronic
1044897250 8:96905487-96905509 CCAGCTGTAATGCTATAATGTGG - Intronic
1045438281 8:102186015-102186037 CCAGCTCTTTCTCTGTTATGTGG + Intergenic
1050253476 9:3770254-3770276 CCAGCTTTTATCCAGGAAGGAGG + Intergenic
1050335076 9:4582859-4582881 ACAGCTCTAATCCTGTAATGAGG + Intronic
1052753737 9:32519627-32519649 TCAGATCTTTTCCTTTAATGAGG + Intronic
1060609526 9:124950258-124950280 CCAACTCTGATTCTGTAATTTGG - Intronic
1062372943 9:136249450-136249472 CCAGCTCTGATGCTGCCATGCGG + Intergenic
1193495639 X:82207983-82208005 CCATCTCTTAAACTGTTATGGGG - Intergenic
1201382071 Y:13391845-13391867 CCAGCTCTTCTCATTTATTGGGG + Intronic
1202075032 Y:21028810-21028832 CCAGCTTTTATTCTGTTATTTGG + Intergenic