ID: 1101825902

View in Genome Browser
Species Human (GRCh38)
Location 12:108219757-108219779
Sequence TACCCAGGACAACCCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101825889_1101825902 23 Left 1101825889 12:108219711-108219733 CCACATTACAGGATAAGAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1101825888_1101825902 24 Left 1101825888 12:108219710-108219732 CCCACATTACAGGATAAGAGCTG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101825902 Original CRISPR TACCCAGGACAACCCCAAAG GGG Intronic
905329369 1:37181577-37181599 TCCCCAGGGGAGCCCCAAAGAGG - Intergenic
906001610 1:42431196-42431218 TCTCCAGGACCACCCCAGAGTGG - Intronic
906800041 1:48729180-48729202 TACTCAGAACAACCCCATACAGG - Intronic
907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG + Intronic
909718148 1:78735443-78735465 GACCAAAGACAACCCCAAAGAGG + Intergenic
910256306 1:85250461-85250483 TTCCCAGGACATCTCTAAAGGGG + Intronic
915860043 1:159434465-159434487 CACTCAGCACAACCCCAAAGAGG + Intergenic
921924307 1:220698836-220698858 CTCCCAGGACAACCCCTAGGAGG - Exonic
1064191816 10:13213023-13213045 TATTCAGGACACCCCCAAACTGG - Intergenic
1064771537 10:18728710-18728732 TAGCCAAGACATCTCCAAAGTGG + Intergenic
1068520273 10:58069892-58069914 TATCCAGGCCATCCCAAAAGTGG - Intergenic
1072036249 10:91565603-91565625 TACCCAGGACACCCTCAAATGGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG + Intergenic
1082726229 11:56740253-56740275 CACCCAGGAACACCACAAAGAGG - Intergenic
1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG + Exonic
1082898143 11:58214861-58214883 TACCCAAGAAAAGCACAAAGAGG - Exonic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG + Exonic
1087094705 11:94307578-94307600 TGCTCAGGGCAACCCCAATGTGG + Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1089418849 11:118315941-118315963 TACCCAGTCCATCCCCAGAGAGG - Exonic
1095327930 12:40920398-40920420 TAACCAGGCCAAACTCAAAGTGG - Intronic
1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG + Intergenic
1096031630 12:48421352-48421374 TAGCAATGACAACTCCAAAGAGG + Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099922549 12:88977457-88977479 TAGCCAGGAAAACTCCAGAGAGG - Intergenic
1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103856270 12:123972979-123973001 TACCCAGGGCAACCGCAGTGCGG - Intronic
1104651387 12:130536955-130536977 AACACAAGACAACCCCAAATTGG + Intronic
1105265228 13:18809212-18809234 CACCCAGGACAACCCCATCAGGG - Intergenic
1113635601 13:111916983-111917005 GACCCAGGACAGTCTCAAAGTGG - Intergenic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG + Intergenic
1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG + Intronic
1120164738 14:81185226-81185248 CACAAAGGACAACCTCAAAGTGG + Intronic
1128680628 15:69648797-69648819 AACTAAGGACAACCCCCAAGAGG - Intergenic
1128991043 15:72260567-72260589 TACCATGAAGAACCCCAAAGTGG - Exonic
1129148706 15:73673115-73673137 GACACAGGACAACTCGAAAGAGG + Intergenic
1130203359 15:81853630-81853652 TACCTAAAACAACCCCAAAAGGG + Intergenic
1132518599 16:377288-377310 GAGCGAGGACCACCCCAAAGAGG + Intronic
1132896343 16:2231039-2231061 TACCCAGGATGCCCGCAAAGGGG - Intronic
1133042552 16:3068173-3068195 TCCCCAGGACGACTTCAAAGAGG + Exonic
1135771154 16:25219596-25219618 TTCCCAGGGGAGCCCCAAAGGGG - Intronic
1137883072 16:52072844-52072866 TACCCAGGACAACCACTACCAGG - Intronic
1141057260 16:80830135-80830157 TACACATGAAAACCCCCAAGGGG - Intergenic
1141664452 16:85458644-85458666 TTCCCAGGACAACCCCACTTTGG - Intergenic
1142124307 16:88402604-88402626 GACCCAGGTCAACTGCAAAGGGG - Intergenic
1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152662474 17:81549123-81549145 CACCCAGGACGACCCCACACAGG + Intronic
1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG + Intronic
1154276485 18:12965855-12965877 TACACTAGACAACCCCAAGGTGG - Intronic
1154423166 18:14252332-14252354 CACCCAGGACAACCCCATCAGGG + Intergenic
925208478 2:2026886-2026908 GCCCCAGGATAACCCCACAGAGG - Intronic
928718936 2:34096929-34096951 TACCCAGGTCAAGAACAAAGTGG - Intergenic
935832041 2:107010550-107010572 TACCCAGGAAAACGCCCCAGAGG - Intergenic
938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG + Intergenic
940737360 2:157468420-157468442 AACCCAGGACTACTCCACAGAGG - Intronic
943357241 2:186871550-186871572 CACCAAGGCAAACCCCAAAGAGG - Intergenic
946383243 2:219363955-219363977 TCCCCAGGCCAGCCCCAAAGGGG - Intergenic
946878718 2:224156718-224156740 TTCCCTTGACAACCCCAAAGAGG - Intergenic
1170672915 20:18451723-18451745 TACTCAGGACAAACCCTGAGAGG + Intronic
1171886063 20:30653152-30653174 CACCCAGGACAACCCCATCAGGG - Intergenic
1175162460 20:57019144-57019166 TGCACAGGACAGCCCCACAGCGG - Intergenic
1176850306 21:13907677-13907699 CACCCAGGACAACCCCATCAGGG - Intergenic
1177824751 21:26069664-26069686 TACCCAGGAGAATCTAAAAGAGG - Intronic
1178616182 21:34135171-34135193 TACCTATAACAACCCCAAACTGG - Intronic
1183273026 22:36873728-36873750 TGCTCAGGACAACCCCACAAGGG - Intronic
950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG + Intergenic
950541409 3:13615391-13615413 TGCCCAGGACAAATCCACAGGGG - Intronic
953810903 3:46112053-46112075 TACTCGGGACACCCTCAAAGGGG - Intergenic
960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG + Intronic
960573006 3:119203913-119203935 TACCCAGGAGAACCCAAAACTGG - Exonic
961661977 3:128473739-128473761 TACCCAGGATAAGCCTAGAGTGG + Intergenic
962375940 3:134858808-134858830 CAGCCAGGACAGCCCCACAGTGG + Intronic
965568253 3:170144411-170144433 TACTCAGAATAGCCCCAAAGTGG - Intronic
970466241 4:16325905-16325927 TACCCTGGAGAACCCCACAAAGG + Intergenic
971835741 4:31760695-31760717 TACCCAGGACAGGCACAATGTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973369658 4:49235152-49235174 CACCCAGGACAACCCCATCAGGG - Intergenic
973391373 4:49560264-49560286 CACCCAGGACAACCCCATCAGGG + Intergenic
975747674 4:77490795-77490817 TACCCAGGACAGCCTGAAACAGG - Intergenic
979127684 4:116997134-116997156 TAGCCAGGACACCTCCAAAAAGG - Intergenic
980903473 4:138927193-138927215 CACCCAGTACAAACCTAAAGTGG + Intergenic
981340021 4:143610948-143610970 CAACCAGGACTACCCCCAAGAGG - Intronic
984937184 4:184899584-184899606 TGCCCAGGCCAACACCAACGTGG + Intergenic
985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG + Intergenic
992509162 5:77416411-77416433 GACCCAGGACAGCCCCAACCTGG - Intronic
996655404 5:125928146-125928168 TACTCGGGACACCCTCAAAGTGG + Intergenic
997698405 5:135879496-135879518 TTCACAGGACATCCCAAAAGTGG - Intronic
1001951719 5:175821028-175821050 ATCCCAGGACAACCCCCAGGAGG - Intronic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1005022243 6:21429514-21429536 CACACAGGACAACCCCAAAAGGG + Intergenic
1006974548 6:38086957-38086979 TAACCAGAACAACCTCAAACTGG + Intronic
1011216232 6:85008791-85008813 TCCCCATGACAACACCAAGGGGG - Intergenic
1016153377 6:140772170-140772192 TCTCCAGGACAACACCAAGGGGG + Intergenic
1018060805 6:160088204-160088226 TGCCCATGAAAACCCCAAGGAGG - Intronic
1021517172 7:21501888-21501910 TACTCGGGACATCCTCAAAGGGG - Intronic
1022850737 7:34259129-34259151 TACCCAGAATGACCACAAAGTGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024539150 7:50461800-50461822 GACCCAGAGCAACTCCAAAGTGG - Intronic
1026164983 7:67901552-67901574 AACACAGGAAAACCCCAAAGTGG + Intergenic
1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG + Intronic
1032757665 7:134906330-134906352 TCACCCGGCCAACCCCAAAGTGG - Intronic
1034850616 7:154489972-154489994 TACACAGGACAACCCAAAGAAGG + Intronic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1038467314 8:27775978-27776000 TACCCAGGAAAAGCCCCAGGGGG + Intronic
1040111835 8:43570147-43570169 CACCCAGGGGCACCCCAAAGTGG - Intergenic
1044992958 8:97812730-97812752 AACCCAAGACAACCTCAGAGTGG + Intronic
1048058643 8:130894261-130894283 TAGCAGGCACAACCCCAAAGAGG - Intronic
1048872847 8:138813121-138813143 GACTCAGGAAGACCCCAAAGAGG - Intronic
1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG + Intergenic
1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG + Exonic
1055842509 9:80522210-80522232 TTCCCAGGACAAACCCTATGTGG + Intergenic
1059807222 9:117815478-117815500 CACCCAGGTCAAACCCACAGAGG - Intergenic
1060155091 9:121313966-121313988 TACCGAGGACACCGCCAAGGAGG + Exonic
1062301425 9:135874024-135874046 TCCCCAGGACAAACACAAATTGG - Intronic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1187912618 X:24124907-24124929 TTCCCAGCACAACCTAAAAGTGG + Intergenic
1189513207 X:41684385-41684407 AACCCTGGGCAAACCCAAAGAGG + Intronic
1190059446 X:47201471-47201493 TAACCAGGACAACCCCGGTGTGG + Exonic
1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG + Intronic
1196725403 X:118890718-118890740 TACTCAGGACGCCCTCAAAGAGG + Intergenic
1197658945 X:129149116-129149138 TGCCCATGTCAACCACAAAGCGG + Intergenic
1198791317 X:140349902-140349924 CACTAAGGACAAACCCAAAGAGG - Intergenic
1198999982 X:142624256-142624278 TTGCCATGACAACGCCAAAGGGG + Intergenic