ID: 1101827163

View in Genome Browser
Species Human (GRCh38)
Location 12:108229398-108229420
Sequence AAAGTCAAACAGCTCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101827156_1101827163 27 Left 1101827156 12:108229348-108229370 CCATTTTACAAATGAGGTAACTT 0: 1
1: 2
2: 203
3: 1949
4: 7648
Right 1101827163 12:108229398-108229420 AAAGTCAAACAGCTCTGACATGG 0: 1
1: 0
2: 3
3: 24
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101827163 Original CRISPR AAAGTCAAACAGCTCTGACA TGG Intronic
903961604 1:27061321-27061343 AAAGTCATACAGCTCATACATGG + Intergenic
905238870 1:36569899-36569921 AAAGTTGCACAGCTCTGAAATGG + Intergenic
905250137 1:36643145-36643167 AAAGCCAAACAGCAATGACTTGG - Intergenic
905720657 1:40197985-40198007 AAAGAAAAACAGCTCTTCCATGG - Intronic
906282106 1:44561572-44561594 AAATTCAAACAGGTCAGCCATGG + Intronic
906639184 1:47431477-47431499 AAAGTGATGCAGCTCTGAGAAGG + Intergenic
907192011 1:52657317-52657339 GAAGTCAGAGAACTCTGACATGG + Intronic
907664815 1:56425431-56425453 AAGGTCAAACAGCTGGCACATGG - Intergenic
907668637 1:56454897-56454919 AAGGTCAATCAGGTCTGGCATGG + Intergenic
907860358 1:58346929-58346951 AAAGTCAAACAGCTAATAGATGG - Intronic
908878839 1:68708180-68708202 GAAGTTAAACAGCTATCACATGG + Intergenic
909091484 1:71231515-71231537 AGAGTCAGAGAGCTCTAACATGG + Intergenic
909215300 1:72879024-72879046 AGAGTCTCACAGCTCTGAGATGG + Intergenic
909595805 1:77405279-77405301 AAAGTCAGACAGCTGCTACACGG + Intronic
910029801 1:82705449-82705471 AAAGTAGAACAGCGCTGAAATGG - Intergenic
910473038 1:87575999-87576021 AAAGTCAAAAAGCTGGGAGATGG + Intergenic
910581444 1:88830135-88830157 AAAGTCACACAGCTCTCATATGG + Intronic
910807338 1:91201994-91202016 AGAGACAAACATCTCTGCCATGG + Intergenic
910911582 1:92240179-92240201 AAAATAGAACAGCTCTCACAGGG - Intronic
911206846 1:95100228-95100250 AAAGTCATATAGCTATGAAAAGG + Intergenic
911772787 1:101768405-101768427 AAAGTTGAAAAGCCCTGACATGG + Intergenic
912128645 1:106572751-106572773 AAGGTCATACAGCTCTTAAATGG - Intergenic
914691086 1:150028134-150028156 TAAATCAAACAGGTTTGACAAGG + Intergenic
917121230 1:171646222-171646244 AAAGTCACACAGCTGGGACATGG - Intronic
918400557 1:184158510-184158532 AAAATCAAACATCCCTGCCATGG + Intergenic
920526828 1:206673428-206673450 AAAGGCACACAGCTCAGACCTGG - Intronic
921719819 1:218459188-218459210 AAAGTCATACAGGTCTTAAAAGG + Intergenic
923611300 1:235496887-235496909 TAAGTCAAACAGCTTGGAAATGG + Intronic
1063585081 10:7345064-7345086 AAAGTGAAAGAACCCTGACAGGG + Intronic
1063621761 10:7655873-7655895 AGAGTCAACCAGATCTGACAGGG - Intronic
1064063942 10:12164312-12164334 GAAGTCAGCCAGCACTGACAGGG - Exonic
1065033053 10:21607803-21607825 AAAAACAAACAGCTCTGATAAGG - Intronic
1066196860 10:33108713-33108735 AAAGTTACACAGCTCAGACATGG + Intergenic
1067145837 10:43693189-43693211 AAAATCACACAGCTCTTACCTGG - Intergenic
1067509770 10:46885140-46885162 AAAGTAAAGCACCTCTGAGAAGG + Intergenic
1067652484 10:48166718-48166740 AAAGTAAAGCACCTCTGAGAAGG - Intronic
1069865298 10:71498666-71498688 AAAGTCACACAGCTAGCACAAGG - Intronic
1070495793 10:77020853-77020875 AAAGTCAAACAGCTATTAAGTGG - Intronic
1073005754 10:100322903-100322925 AAAGTCAAACAGCTTGCTCAAGG - Intronic
1073716541 10:106114639-106114661 AAAGCCAAGCTGCCCTGACAGGG - Intergenic
1075302744 10:121340207-121340229 AAAATCTAACAGCTTTGCCAGGG - Intergenic
1075547977 10:123369878-123369900 AATGTCAAACATCTGTGAGAGGG + Intergenic
1079326422 11:19496489-19496511 ACACTCAAGCAGCCCTGACAAGG - Intronic
1080017776 11:27525708-27525730 AAAGTCACCCAGCTCTGAGCAGG + Intergenic
1080328183 11:31102920-31102942 AAAGTCACACAGCTGGTACATGG - Intronic
1080646003 11:34188163-34188185 AAAGTCACACAGCTAGGAAATGG + Intronic
1080772635 11:35355999-35356021 AAAGAGAAACAGCTCTGTAATGG - Intronic
1081385356 11:42465741-42465763 AGAGTCAAAGAGCTCTTAGATGG - Intergenic
1082708975 11:56529421-56529443 AAAATCAACCAGCTCTTTCAAGG - Intergenic
1082742134 11:56922723-56922745 AATGACAAATAGCTCTGATAGGG - Intergenic
1082758696 11:57104611-57104633 GAAGTTAAACTGCTATGACAAGG - Intergenic
1082897320 11:58205592-58205614 AAAGGTAAACGGCTCTCACAAGG + Intergenic
1082897965 11:58213326-58213348 AAAGGTAAACGGCTCTCACAAGG - Intergenic
1085041686 11:73330666-73330688 AAAGTCACACAGTACAGACAAGG - Intronic
1085815280 11:79730828-79730850 AAAGTAAGCCAGCTCTCACAGGG + Intergenic
1086043653 11:82507972-82507994 AAAGTCAAACAGCTGTAAGCTGG - Intergenic
1087750730 11:102003873-102003895 AAATTGTAACAGCTTTGACATGG - Intergenic
1087801689 11:102511340-102511362 AAAGACAAAAAGATCTTACATGG - Intergenic
1088030748 11:105246600-105246622 AAAGTAAAACCGATCCGACATGG + Intergenic
1088583028 11:111333704-111333726 CAATTCAAACAGCTCAGATAAGG - Intergenic
1089643038 11:119860146-119860168 AAGGTCACACAGCTTTGAAATGG + Intergenic
1090244203 11:125204089-125204111 GCATTCAAACAGCTCTGAGAAGG - Intronic
1090428067 11:126623978-126624000 AAGATCCAACAGCTCAGACAAGG + Intronic
1091900999 12:4143845-4143867 AAACTCAAACAGCACAGAAATGG + Intergenic
1092660767 12:10735661-10735683 AAAGTGAACCAGCTCTTACCAGG + Intergenic
1094610419 12:31990334-31990356 CAAGTCATACAGCTTTGTCATGG + Intronic
1096781259 12:53993556-53993578 TAAGCCCAACAGCTCTGAAACGG - Intronic
1097143737 12:56925388-56925410 AAAGTCAGACTGCCCTGATAAGG + Intronic
1097584976 12:61504495-61504517 AAAGTAAAACATTTATGACAAGG - Intergenic
1097604505 12:61735993-61736015 AAAGTAGAACAGCCCTCACAGGG - Intronic
1097892823 12:64795110-64795132 AAAGTCAATAAGCCCTGCCAGGG - Intronic
1098754560 12:74343362-74343384 AAAGTCACACAGCAATGAAAAGG - Intergenic
1099791401 12:87339449-87339471 CAAATCAAACAGCTCTGACATGG - Intergenic
1100346857 12:93740865-93740887 AAAGTCAAACAGCTTTTAAAAGG - Intronic
1101577269 12:106009216-106009238 AAAGTCACACAGCTGATACATGG - Intergenic
1101827163 12:108229398-108229420 AAAGTCAAACAGCTCTGACATGG + Intronic
1102788614 12:115624557-115624579 AAAGGCAAATAGCCCTAACAGGG + Intergenic
1103733061 12:123041508-123041530 CAAGTCACACTGCTCTGATACGG - Intronic
1103800146 12:123532918-123532940 AAAGTCACACAGCTATTAAACGG + Intronic
1105905422 13:24805035-24805057 AAGATCACACAGCTCTGAAAGGG + Intronic
1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG + Intronic
1107377927 13:39824519-39824541 TAAGTGAAACAGCTCTGAGAAGG - Intergenic
1110080108 13:71298853-71298875 AAAATCAAACACTTCTGATAAGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1111648040 13:91056830-91056852 AAAGGCAAACACCTCAGGCAGGG + Intergenic
1111683084 13:91468049-91468071 AAAGCCAAACATCTCAGATAGGG - Intronic
1113068109 13:106392221-106392243 AAACTCAAACAGCTCTTGCTTGG + Intergenic
1115006166 14:28487943-28487965 AAACACAAACAGATCTGACTAGG + Intergenic
1115448265 14:33517034-33517056 AATATTAAACAGTTCTGACATGG + Intronic
1116747065 14:48833768-48833790 ATATACAGACAGCTCTGACAGGG - Intergenic
1117101901 14:52357346-52357368 AAAGTTAAAAAGCTTTCACATGG + Intergenic
1118580558 14:67291869-67291891 AAAGTCAAACAGCTTTTCTAGGG - Intronic
1119066923 14:71537713-71537735 AAAGTAAAACTTCTCTGTCAAGG - Intronic
1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG + Intronic
1120123598 14:80713394-80713416 AAAGTCATAGAGCTTTGAAAAGG - Intronic
1121765899 14:96485286-96485308 AAAGTCACACAGCCCAAACAGGG - Intronic
1121971211 14:98358187-98358209 AATGACAAACAGCTCTGCCTTGG - Intergenic
1124233286 15:27965494-27965516 AAAGTCACACAGATCTGTCTTGG + Intronic
1124887872 15:33703676-33703698 AAAGACAAACCCCTCTGTCATGG - Intronic
1130316130 15:82798744-82798766 AAAGTTAAACAGAGCTGATAGGG - Intronic
1130661442 15:85834143-85834165 AAAGTCTTCCAGCTCCGACAAGG - Intergenic
1132319653 15:100916847-100916869 AAACTCAGCCAGCTATGACATGG - Intergenic
1134679264 16:16112618-16112640 AAAGTCACACAGCTAATACATGG + Intronic
1137781051 16:51098202-51098224 AAAATGAAGCAGCTCTTACATGG + Intergenic
1137796359 16:51223597-51223619 AACATCAAACAGCTGTGAAAAGG + Intergenic
1141913223 16:87075329-87075351 AAACTTAAACAGCACTGAAAGGG + Intergenic
1143736456 17:8914976-8914998 AAAGTCACACAGCTAGGAGATGG + Intronic
1145389855 17:22447133-22447155 AAAGTCAAACAGATACCACATGG - Intergenic
1145879929 17:28345536-28345558 AAAGCCAAAGAGCTGTCACATGG + Exonic
1145953383 17:28837565-28837587 TAAGTCACAGAGCTTTGACAGGG + Intronic
1146172006 17:30641653-30641675 AAGGTCACACAGCTATTACATGG - Intergenic
1146175938 17:30666855-30666877 AAGGTCACACAGCTATGAAATGG + Intergenic
1146345464 17:32057689-32057711 AAGGTCACACAGCTATTACATGG - Intergenic
1146349392 17:32082963-32082985 AAGGTCACACAGCTATGAAATGG + Intergenic
1151789917 17:76298606-76298628 AAAGACAAAGAGGTCAGACATGG - Intronic
1152786524 17:82250849-82250871 AAAGTAATTCAGCTCAGACATGG + Intronic
1153483934 18:5576075-5576097 AAAGTCAAACAGCTCTGTTAAGG + Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1156553655 18:38043850-38043872 CAAATCAAACACCCCTGACAGGG + Intergenic
1158782126 18:60663933-60663955 AAAGCTAAAGAGCTCTGACTGGG - Intergenic
1159620671 18:70634667-70634689 AAATTCAAAGTGCTCTGCCAAGG - Intronic
1161867796 19:6847475-6847497 AAAGGGAAGCAGCACTGACATGG - Intronic
1162042124 19:7977343-7977365 GTAGTGAAACAGCTCTGCCAAGG - Intronic
1162982889 19:14250053-14250075 AAGGTCACACAGCTATGAAATGG - Intergenic
1166324100 19:42038546-42038568 CAAGTCAGAAAGCTCAGACAAGG + Intronic
1167269968 19:48501109-48501131 AAACTCAAACAGCTCCCACAGGG + Exonic
1167654272 19:50753264-50753286 ACAGTCAAATACCTCTGACCAGG - Intergenic
1168347473 19:55657817-55657839 AAGGTCAAACAGCTAGGAAATGG - Intronic
924969704 2:114501-114523 AAAATCACTCAGCTCTTACATGG + Intergenic
925479698 2:4256373-4256395 AAAGGCAATCAGTTCTGATAAGG + Intergenic
926315498 2:11706734-11706756 AAGGTCACACAGCTCTAACCTGG - Intronic
927926188 2:27015374-27015396 CAAGTCAGACAGCTAGGACATGG + Intronic
928734153 2:34266464-34266486 CAAGTCAAAGACCACTGACAGGG - Intergenic
928777855 2:34788555-34788577 ACAGTAAAACAGGACTGACATGG + Intergenic
929625252 2:43400073-43400095 AAATACAAATAACTCTGACATGG + Intronic
931844127 2:66185224-66185246 AAAGCCATACAGCTCTCAAATGG + Intergenic
933390709 2:81663165-81663187 AAACTCAAGCATCTCTAACAAGG + Intergenic
933458345 2:82545772-82545794 CAAGTGAAACAACTCAGACATGG - Intergenic
938755768 2:134377616-134377638 AAAGTCACACAACACTTACATGG + Intronic
939154779 2:138511873-138511895 AAAGTCATACAGCTATTAAATGG - Intronic
939878632 2:147605248-147605270 TTAGTCAAATGGCTCTGACATGG - Intergenic
942824518 2:180158794-180158816 AAAGTCAAATGGTTCTGAAAAGG - Intergenic
943961423 2:194268933-194268955 AAACTCAACCATCTCTCACATGG + Intergenic
944206080 2:197160154-197160176 AAAGTCACACAGCTCATACGTGG - Intronic
945512908 2:210724795-210724817 AAAGACAAATAACTCTGAAATGG - Intergenic
945917132 2:215715752-215715774 AAAGTCACACAACTTTGCCAAGG + Intergenic
947079211 2:226377387-226377409 CAAGAGAAACAGCTATGACACGG + Intergenic
947777507 2:232725463-232725485 AAAGTTAAGCAGCTCACACAAGG - Intronic
1169510053 20:6254402-6254424 GAACTCAAACAGCTCAGAAAGGG - Intergenic
1172589380 20:36106424-36106446 AAAGTCACCCAGCTTTGACTAGG - Intronic
1174066863 20:47871925-47871947 AAACTTAAACAGCACTGACAAGG + Intergenic
1174862548 20:54104611-54104633 AACGTCACACAGCTAGGACACGG + Intergenic
1175174047 20:57099603-57099625 AAAGAAAAACAGCACTGAAAGGG - Intergenic
1175994521 20:62806057-62806079 AAAGTGAAACAGCCCCGCCAGGG - Intronic
1177718854 21:24878366-24878388 GAAGTCAAATAGCTGTGTCATGG + Intergenic
1178746283 21:35253409-35253431 AAGGTCATACAGCTCAGATATGG - Intronic
1182011114 22:27001466-27001488 ACAGTCACACAGCTCTGAAGTGG - Intergenic
1182088400 22:27577284-27577306 AAAGGGAAACAGCTCAGAGAAGG - Intergenic
1182118268 22:27770475-27770497 AAAGTCACACAGCTGGGACAAGG - Intronic
1182853655 22:33498569-33498591 AAATTAAATCAGCTCTGAAAGGG - Intronic
1184373418 22:44097102-44097124 AAAGTCACACAGCTCAGAGATGG + Intronic
949262865 3:2122229-2122251 AAAGGCAAACAGTTTTGACCAGG - Intronic
949887920 3:8711142-8711164 AAAGTCACACAGCTTGCACATGG - Intronic
949903541 3:8839439-8839461 AAAGTCACACAGCTAGTACAAGG + Intronic
950471359 3:13188565-13188587 AAAGTCACACAGCTCTTACGAGG + Intergenic
950956100 3:17054883-17054905 AAAGTCACACAGCAGGGACATGG - Intronic
951067034 3:18278464-18278486 AAAGCCAAACAGCACTGAATGGG + Intronic
956944521 3:74204857-74204879 AAAGTCAAACAACTCTACCCAGG + Intergenic
957589611 3:82178797-82178819 AAAGTCAAACAGCTAAGACCAGG - Intergenic
958570909 3:95882057-95882079 AAAGACAAACAGCTCTGGAATGG + Intergenic
959541420 3:107543766-107543788 AAAATCTAACAGCTTTGAAATGG - Intronic
959884518 3:111483442-111483464 AAAGTCATACAGCTCATAAATGG + Intronic
961084611 3:124056129-124056151 AAAGTTAAACAACCCTGAAAGGG - Intergenic
961380515 3:126493628-126493650 AAGGTGAAAAAGCTCTGAGATGG + Intronic
962053823 3:131847709-131847731 AAAGAGAAACAGCCTTGACAAGG - Intronic
962625467 3:137221537-137221559 AAAGTCAAACAGCTGAGATGTGG + Intergenic
964805207 3:160602087-160602109 AAATTCAAACATCCTTGACATGG + Intergenic
968279721 3:197467153-197467175 AGAGGGAAACAGCTCTGAAATGG + Intergenic
970908711 4:21248855-21248877 AAAGTCAAACACCTATTAAATGG + Intronic
972488403 4:39563795-39563817 ACAGTCAAACAGCTATGAGATGG - Intronic
973752336 4:54033959-54033981 AAAGCAAAACAACTCTGAAAAGG - Intronic
975190639 4:71456997-71457019 AAAGGCAGACAGCTCAGAGATGG + Intronic
975926024 4:79454715-79454737 AAAGTCATACAGATCAGAAAGGG - Intergenic
975987171 4:80211598-80211620 AAAGTCAAATACCTCTGATTTGG - Intergenic
976654107 4:87469379-87469401 AAAGTCACACAGCTAGCACATGG + Intergenic
977619430 4:99119852-99119874 CAATTCTAACAGCTCTGCCAAGG + Intergenic
977770396 4:100851075-100851097 GAAGTGACACAGTTCTGACATGG + Intronic
980182690 4:129421465-129421487 AACGTCAAAATGCTCTGACAAGG - Intergenic
980985061 4:139687110-139687132 AAAGCAAAACATCTCTAACAAGG - Intronic
981030252 4:140118263-140118285 AAAGTCATACAGCTAGTACACGG - Intronic
983838736 4:172427740-172427762 ACAGTCAAAAAGTTCAGACATGG - Intronic
984075816 4:175178490-175178512 AAAGTGAAAGAGCACTGACATGG + Intergenic
985039243 4:185872418-185872440 AAATTCCCACAGCTCTGCCAAGG - Intronic
987189985 5:15467240-15467262 TAAGTTAAACAGCTCAGAAACGG + Intergenic
989391368 5:40904153-40904175 TAAGTCAAACAGCTCTGAGAAGG - Intergenic
993181661 5:84561501-84561523 AAAGTCAATCAGTTCTGGAAAGG + Intergenic
993288016 5:86025630-86025652 AAACTTACACAGCTTTGACAGGG + Intergenic
995726750 5:115189403-115189425 AAAGTCTCACAGCTATAACATGG - Intergenic
995736000 5:115299603-115299625 AAAGTCAAAACTCTATGACAAGG + Intergenic
998809485 5:145951938-145951960 AAAGTCATACAGCTATCAAAAGG - Intronic
1000478177 5:161738254-161738276 AAAGACAAAGAGCTCCGAAAGGG + Intergenic
1000893409 5:166826501-166826523 AAAGACAAACAGGCCTGGCATGG + Intergenic
1004848033 6:19667481-19667503 AAAGTCAAACAGGCCGGGCATGG + Intergenic
1010649899 6:78441471-78441493 AAAGTCAATCAGGTATAACATGG - Intergenic
1011224113 6:85088164-85088186 AAAGTCACACAGCTAAGAAATGG + Intergenic
1012718950 6:102716467-102716489 AAGGAGAAACAGCACTGACAAGG + Intergenic
1014902229 6:126981204-126981226 AAAATCAAACAGTTATCACAAGG + Intergenic
1015485596 6:133766540-133766562 AAAGTTAAACACCTCTAAAATGG + Intergenic
1018282642 6:162204338-162204360 AGAGTCACTCAGCTCTGAGAAGG - Intronic
1018501187 6:164412694-164412716 AAAGCCAACCAGGTCAGACATGG + Intergenic
1019016120 6:168880727-168880749 AAGGTCACCCAGCTCTGCCAAGG - Intergenic
1019084036 6:169457401-169457423 AAAGACATAAAACTCTGACATGG + Exonic
1020467045 7:8492365-8492387 ACAATCACACAGCTCTTACATGG - Intronic
1023361290 7:39418397-39418419 AAAGTTAAACAGGTCAGGCACGG + Intronic
1024683320 7:51717340-51717362 AAAGTCAAACACCACTGTGATGG + Intergenic
1027394865 7:77744014-77744036 AAAGTAAAACAGTCCAGACATGG - Intronic
1027850850 7:83449956-83449978 AATGTCAAACAGCTCTTAAATGG + Intronic
1029558275 7:101285533-101285555 AAAGTCAAAGCCCTCTGACCTGG + Intergenic
1031811798 7:126378961-126378983 GATGACAAAAAGCTCTGACATGG + Intergenic
1032375352 7:131410274-131410296 AAAATCACACAGCTCTTAAATGG - Intronic
1037124456 8:15329377-15329399 AAAGTCAAAAATCAATGACAAGG - Intergenic
1038141264 8:24847951-24847973 AAGGTCATACAGCTGTGAGAAGG + Intergenic
1038232385 8:25714539-25714561 AAAGTCAAACAGCTATTATGTGG - Intergenic
1038670351 8:29578063-29578085 AAGTTCAAACAGCTCTTTCAAGG - Intergenic
1038894950 8:31772192-31772214 AAAGTTTAACAGCTTTGAAAAGG - Intronic
1039590820 8:38745443-38745465 AAAGTCAATCAAATCTGACCTGG + Intronic
1039804738 8:40988177-40988199 AAAGTAAAACTGCTCTCAAAAGG - Intergenic
1041244203 8:55875460-55875482 AAAAAAAAACAGGTCTGACATGG - Intergenic
1041898079 8:62949239-62949261 AAAGTCAATCAGGTTTGCCATGG + Intronic
1042939053 8:74089203-74089225 AAAGATAAACAGTTCTCACAGGG - Intergenic
1042957547 8:74267831-74267853 AAAATGAAGCAGCTCTGAAAAGG + Intronic
1042986417 8:74588790-74588812 AAAATTTAACAGCTCTCACAAGG - Intergenic
1043058537 8:75470956-75470978 AAAGCCATACAGTTGTGACAAGG - Intronic
1044430130 8:92098559-92098581 AAAGACAAACAACTTAGACATGG - Intronic
1045163556 8:99577214-99577236 AAAGTCAAATAGGTATGAAAAGG + Intronic
1045444639 8:102248078-102248100 AAAGTAAAACAGCTTTGTCAAGG + Intergenic
1046105627 8:109662532-109662554 AAAGCCAAGAATCTCTGACATGG + Intronic
1046291952 8:112173854-112173876 AAAGTCAAATAGCTAGGAAAAGG + Intergenic
1047401455 8:124551934-124551956 AAACTCGAACAGATTTGACAAGG - Intronic
1050530459 9:6583921-6583943 AAAATCAAAAAGCTCTCAGACGG + Intronic
1051009360 9:12392271-12392293 AAATTCAAACAGCTGTGAAATGG + Intergenic
1052431289 9:28370007-28370029 AATATTAAACAGCTCTCACATGG + Intronic
1052495538 9:29219065-29219087 AAAGTCAAAAAGCCTTGCCAAGG + Intergenic
1055715558 9:79113829-79113851 CAAGTGACACAGCTATGACAAGG + Intergenic
1058131719 9:101260969-101260991 AAAGTAAAAAAGCACTGAAAAGG + Intronic
1058256517 9:102772517-102772539 TAAGTGAAATAACTCTGACATGG - Intergenic
1058602008 9:106680436-106680458 CAAGTCAGACAGTTCTGACTTGG - Intergenic
1059001728 9:110355719-110355741 AAAGTCAAACTATTCTGATAAGG + Intergenic
1059713440 9:116890590-116890612 AGAGTCACACAGCTTTGACAGGG - Intronic
1060202003 9:121656829-121656851 AAAGCCACACAGCTCAGAAATGG + Intronic
1060569371 9:124624048-124624070 AAAGTCAAACAGCTAGTAAAGGG + Intronic
1061296301 9:129678696-129678718 AAAGTCACACACCTCAAACAAGG - Intronic
1185863633 X:3603195-3603217 AAAGTCAGAGAGCTCCAACAGGG + Intergenic
1187984495 X:24795780-24795802 AAAGACAAACACCTCTATCATGG - Intronic
1188534131 X:31177040-31177062 AAAATCAGACAGCTCTGTTATGG - Intronic
1188687567 X:33087631-33087653 AAGGTCACACAGCTATCACATGG - Intronic
1190456641 X:50634225-50634247 AGTGTCACACAGCTGTGACAAGG + Exonic
1192496834 X:71621852-71621874 AAAGTCACACAGCTCGAACAGGG - Intergenic
1193052602 X:77116867-77116889 AAAGAAAAACAGCTCTGATGTGG + Intergenic
1195871001 X:109485617-109485639 AAAGTCACACAGCTGATACATGG + Intergenic
1195988927 X:110663484-110663506 AAAGTCACACAGCAAGGACAGGG + Intergenic
1196388441 X:115185337-115185359 AAAGTCACACAGCTGTTAAATGG + Intronic
1196624293 X:117860560-117860582 AAGGTCAAACAGCTCTTAGGAGG - Intergenic
1197133176 X:123029720-123029742 AAAGTCAAACAGTACAGAAAGGG - Intergenic
1197886877 X:131227480-131227502 AAAGCCAAACTTCTCTGCCATGG + Intergenic
1198035166 X:132794821-132794843 ACAGTCATACACCTCAGACATGG + Intronic
1198228461 X:134668424-134668446 AAAGTCACACATCTATGAAATGG + Intronic
1199099289 X:143780438-143780460 AGATTCAAACTGCTCTGATATGG - Intergenic
1200672499 Y:6111525-6111547 TAATTCAATCACCTCTGACAGGG - Intergenic