ID: 1101827711

View in Genome Browser
Species Human (GRCh38)
Location 12:108233323-108233345
Sequence TTGTCGACTTAAATGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101827711_1101827713 -8 Left 1101827711 12:108233323-108233345 CCTCTCCACATTTAAGTCGACAA 0: 1
1: 0
2: 1
3: 2
4: 72
Right 1101827713 12:108233338-108233360 GTCGACAATATTCGCTATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1101827711_1101827714 -7 Left 1101827711 12:108233323-108233345 CCTCTCCACATTTAAGTCGACAA 0: 1
1: 0
2: 1
3: 2
4: 72
Right 1101827714 12:108233339-108233361 TCGACAATATTCGCTATGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101827711 Original CRISPR TTGTCGACTTAAATGTGGAG AGG (reversed) Intronic
903583870 1:24393347-24393369 TCATCTACTTAAATGGGGAGGGG - Intronic
907771268 1:57466842-57466864 CTGTTGACTTGAAGGTGGAGAGG - Intronic
914409989 1:147418083-147418105 TTGTTGGCTTAAAGATGGAGGGG - Intergenic
918988576 1:191666359-191666381 TTGTTGTCTTGAATTTGGAGGGG + Intergenic
919075381 1:192807633-192807655 TTGTGGACTTTATTGTGGAAAGG - Intergenic
921821764 1:219624676-219624698 TTGTGGAAATAAATGTGGAAAGG - Intergenic
921978884 1:221233572-221233594 TTGTGGACTACAATGTGTAGGGG - Intergenic
1068700652 10:60016156-60016178 TAGAAGACTTGAATGTGGAGAGG + Intergenic
1074046686 10:109845868-109845890 TTGTTGGGTGAAATGTGGAGTGG - Intergenic
1076840394 10:133042439-133042461 TTGTCCACATGAATGTGGTGTGG - Intergenic
1077962808 11:7092478-7092500 TTGAAGATTTAAATGTGAAGAGG + Intergenic
1078261150 11:9710116-9710138 GGGTCCACTTAAATGTGGACTGG - Intronic
1080090029 11:28336580-28336602 TTGTTGACTAAAATGTTAAGTGG - Intergenic
1082773205 11:57224896-57224918 TTGGTGACTTGAATGTGGAATGG - Intergenic
1086457297 11:86971928-86971950 TTGCAGACTTAAATGTGGTTGGG - Intergenic
1093284974 12:17247742-17247764 TTGTTGACTTCAAAGTTGAGGGG - Intergenic
1101827711 12:108233323-108233345 TTGTCGACTTAAATGTGGAGAGG - Intronic
1103389468 12:120561013-120561035 TTATTGTCTTAAATGTGGAATGG - Intronic
1104162747 12:126195815-126195837 TTGTGGACTTAAAGGAAGAGAGG + Intergenic
1105064711 12:133186295-133186317 ATGTAGAGTAAAATGTGGAGCGG + Intronic
1107151160 13:37113410-37113432 TTGACTCCTTAAATCTGGAGTGG + Intergenic
1108008546 13:45978241-45978263 TTGTAGAATTTAATGGGGAGAGG - Intronic
1111752856 13:92356863-92356885 TGGTCTACTTGAAGGTGGAGTGG - Intronic
1119124316 14:72111522-72111544 TTGAAGACATAAATGTGGATTGG - Intronic
1123464440 15:20505034-20505056 CTGTTGAGTTAACTGTGGAGGGG - Intergenic
1123653671 15:22496007-22496029 CTGTTGAGTTAACTGTGGAGGGG + Intergenic
1123744096 15:23304866-23304888 CTGTTGAGTTAACTGTGGAGGGG + Intergenic
1124275169 15:28321004-28321026 CTGTTGAGTTAACTGTGGAGGGG - Intronic
1124307531 15:28590595-28590617 CTGTTGAGTTAACTGTGGAGGGG + Intergenic
1142844662 17:2663642-2663664 TTGTTGGCTTAAATATTGAGAGG + Intronic
1150141401 17:62732553-62732575 ATTTGGACTTAAATGTGAAGTGG - Intronic
1151997624 17:77620161-77620183 TTGTTGAATTAAATGCAGAGAGG - Intergenic
1156195352 18:34768442-34768464 GTGTCCACTTTAATGTTGAGTGG - Intronic
1164155179 19:22591101-22591123 TTCTCGGCTTAAATTTAGAGAGG - Intergenic
1165055304 19:33172748-33172770 GTGTCGACTTGAAGGTGGTGAGG + Intronic
926291727 2:11536551-11536573 TTGTCATGTTTAATGTGGAGAGG + Intronic
927783890 2:25959146-25959168 TTTTCCAGTTAGATGTGGAGTGG - Intronic
929377437 2:41306208-41306230 TTGTAGTTTTACATGTGGAGTGG - Intergenic
929758922 2:44790314-44790336 TTGTCACCATAAATCTGGAGCGG - Intergenic
930718453 2:54615380-54615402 TTGTAGAGTAAAATGTGGAATGG - Intronic
940132596 2:150400566-150400588 TTGTCCACTTACATGTTGAAAGG - Intergenic
944291890 2:198017392-198017414 TTGTCCAGTTAAATCTGCAGAGG + Intronic
945659130 2:212663492-212663514 TTGTAAACTTAAATGTGGAGAGG - Intergenic
1170584497 20:17724186-17724208 TGGTCCATTTAAAAGTGGAGAGG + Intronic
1173036204 20:39413519-39413541 GTGTCTACAAAAATGTGGAGGGG + Intergenic
1179534238 21:42041011-42041033 GTGTGGACTGAAATGGGGAGTGG + Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
960940726 3:122931883-122931905 TTGTGGACTGAAACGTCGAGGGG + Intronic
964623400 3:158736753-158736775 TTGTCCACTTACCTGTGGGGTGG + Intronic
968332471 3:197883556-197883578 TTCTCTTCTAAAATGTGGAGAGG - Intronic
975451201 4:74529038-74529060 TTTAGGACTTAAATGTAGAGGGG - Intergenic
978585357 4:110270862-110270884 TTGTATATTTAAATTTGGAGAGG + Intergenic
980695186 4:136345539-136345561 TTGCCGGCTTAAAGATGGAGGGG + Intergenic
980700370 4:136419847-136419869 TTGTCAACTCAAATGTATAGAGG + Intergenic
985256620 4:188076550-188076572 ATATCGACTGACATGTGGAGTGG - Intergenic
986391463 5:7291228-7291250 CTGTTGAGTTAACTGTGGAGGGG + Intergenic
990018149 5:51091641-51091663 TTCTCGATTTTAAAGTGGAGGGG + Intergenic
992798002 5:80270499-80270521 TTGTAGACTTGAAAGTGGAAGGG + Intergenic
1002510074 5:179709911-179709933 TGGTCCAGATAAATGTGGAGAGG + Exonic
1006605444 6:35253306-35253328 TTGTGGACTGTACTGTGGAGAGG - Intergenic
1010281794 6:74030811-74030833 TTAAAGACTTAAATGTGGGGTGG - Intergenic
1011082523 6:83505366-83505388 TTGTCAAATTAAATGTGGCTAGG + Intergenic
1017375805 6:153766660-153766682 TGGTCGACATACATGTGGTGAGG - Intergenic
1027063703 7:75106003-75106025 TTGCCCACTTGAATGTGGTGTGG - Intronic
1031176496 7:118359070-118359092 TTGTCCATTTCAATGGGGAGTGG + Intergenic
1031811444 7:126374512-126374534 TTGTCAACTTAAATAACGAGAGG + Intergenic
1048132390 8:131712121-131712143 TTTTTGACTAAAATGTGGAGGGG - Intergenic
1049066505 8:140320629-140320651 TTGGCTAGGTAAATGTGGAGAGG - Intronic
1052830914 9:33214703-33214725 TTGTCGACGTAAGTGTGGTGTGG - Intergenic
1057360095 9:94365450-94365472 ATGTCAACTTAAAAGTGTAGGGG - Intergenic
1057663245 9:97022638-97022660 ATGTCAACTTAAAAGTGTAGGGG + Intergenic
1189276486 X:39790114-39790136 TTGTTGACTTTAAGATGGAGGGG - Intergenic
1194674946 X:96783180-96783202 TTTGTGACTAAAATGTGGAGAGG + Intronic
1195124350 X:101790716-101790738 TTGCCCAATTACATGTGGAGTGG - Intergenic
1197145984 X:123172888-123172910 TTTTCCACTTAAATTTTGAGAGG + Intergenic
1197548471 X:127857558-127857580 TTGTAGCATGAAATGTGGAGTGG - Intergenic