ID: 1101827775

View in Genome Browser
Species Human (GRCh38)
Location 12:108233813-108233835
Sequence GGGCATGGTGGGAGACATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101827765_1101827775 0 Left 1101827765 12:108233790-108233812 CCTTGGGCATGAAGCCCTCTCCT 0: 1
1: 0
2: 2
3: 28
4: 213
Right 1101827775 12:108233813-108233835 GGGCATGGTGGGAGACATCAGGG 0: 1
1: 0
2: 4
3: 34
4: 330
1101827763_1101827775 2 Left 1101827763 12:108233788-108233810 CCCCTTGGGCATGAAGCCCTCTC 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1101827775 12:108233813-108233835 GGGCATGGTGGGAGACATCAGGG 0: 1
1: 0
2: 4
3: 34
4: 330
1101827764_1101827775 1 Left 1101827764 12:108233789-108233811 CCCTTGGGCATGAAGCCCTCTCC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1101827775 12:108233813-108233835 GGGCATGGTGGGAGACATCAGGG 0: 1
1: 0
2: 4
3: 34
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101827775 Original CRISPR GGGCATGGTGGGAGACATCA GGG Intronic
900467088 1:2831130-2831152 GGGCAGGGTGGCAGAGCTCAGGG - Intergenic
901276677 1:7996944-7996966 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
901575598 1:10198370-10198392 GAACATGGAGGGAGACATCGGGG - Intergenic
902122275 1:14176452-14176474 GGGCAGGGTATGAGACATGAGGG + Intergenic
902618252 1:17635516-17635538 GGGCGTGGTGGGAGGGAGCATGG - Intronic
903887088 1:26546822-26546844 GGGCATGGTGGGCCCCATCCAGG - Intronic
903987971 1:27242812-27242834 GGGCAGGGGAGAAGACATCAAGG + Intronic
904007573 1:27371659-27371681 GGGGGAGGTGGAAGACATCAGGG - Intronic
904330543 1:29755510-29755532 GGGTATGGAGGGAGACCCCAGGG + Intergenic
904416132 1:30362085-30362107 GGGTATGGAGGGAGACCCCAAGG - Intergenic
905139382 1:35829694-35829716 GGGCATGGTGGCAGGCATGGTGG + Intronic
905637511 1:39564685-39564707 CAGCAAGGTGGGAGACCTCAAGG - Exonic
905980231 1:42218870-42218892 TGGCATGGTGAGAAACAACAAGG - Intronic
906942234 1:50265445-50265467 GGGAATGGCTGGAGCCATCAGGG - Intergenic
907312468 1:53546855-53546877 GGGCATGGTGGGGGACCCCAGGG - Intronic
908415424 1:63908846-63908868 TGGCATGGTGGGAGAAGTCAGGG - Intronic
908515938 1:64892848-64892870 GGGCAAGGTGTGGGACTTCAGGG + Intronic
908583249 1:65540353-65540375 GGGCCTGGTGGGAGATATTTGGG + Intronic
908872187 1:68626159-68626181 GGGCAGGGTGGGAGATTTTAGGG + Intergenic
910355575 1:86349872-86349894 GGGCACTGTGGGAGACACCAGGG + Exonic
911266013 1:95743849-95743871 GGGAAAGGGGAGAGACATCAGGG + Intergenic
915917414 1:159949298-159949320 GGGCGTGGTGGGAAAAGTCACGG - Intergenic
916144295 1:161726081-161726103 GTGCAAGGTGGGAGAGACCAGGG + Exonic
917121168 1:171645845-171645867 GGCCATGGTGGGATTCAGCAGGG - Intronic
917445116 1:175100264-175100286 TGGGATAGGGGGAGACATCAGGG - Intronic
917454802 1:175177102-175177124 GGGGATGGTGGGAGAGGCCAGGG + Intronic
918180241 1:182081042-182081064 GGGGTTTGTGGGAGACTTCATGG + Intergenic
918246159 1:182661289-182661311 GGGCCTGGTGGGATAGGTCAGGG + Intronic
918526211 1:185467471-185467493 GGGCAGGATGGGGGACATGATGG + Intergenic
918726229 1:187927825-187927847 GGGAATGGTGGGTAACATCTAGG + Intergenic
920549081 1:206843381-206843403 CAGCAGGGTGGGAGACAGCACGG + Intergenic
920556296 1:206907275-206907297 GGAAATGGTGGGAAACGTCAGGG + Intronic
921662857 1:217827872-217827894 GGGCCTGTTGGGAGAGAGCAGGG + Intronic
922107340 1:222523931-222523953 GGGCATGGTGGCAGTCAAAACGG + Intronic
922214620 1:223510220-223510242 GGGCCTGGGGGGAGGTATCATGG + Intergenic
922664220 1:227454989-227455011 GGAAATGCTGGGAGACACCAGGG + Intergenic
922913144 1:229234052-229234074 AGGCATGATGGGAGAGAGCAGGG + Intergenic
1063038611 10:2314744-2314766 GGGCATGGAGGGGGAACTCAGGG + Intergenic
1064273075 10:13882382-13882404 AGGCATGGTGAGTCACATCATGG + Intronic
1064313679 10:14235287-14235309 GGGCATGGTGGCGGGCACCAGGG - Intronic
1066281049 10:33918654-33918676 GGGCATGGTGGGGGTCAGGATGG + Intergenic
1066436142 10:35398051-35398073 GGGCATGGATGGAGGCAGCAGGG + Intronic
1066486319 10:35848576-35848598 AGGCATTGTGGGAGATTTCATGG + Intergenic
1066653109 10:37678413-37678435 GGGCCACGTGGGAGACACCATGG - Intergenic
1067307287 10:45076126-45076148 AGGCATTGTGGGAGATTTCATGG + Intergenic
1067353841 10:45505155-45505177 AGCCATGGAGGGAGCCATCAAGG - Intronic
1070772912 10:79092731-79092753 AGGCTTGCTGGGAGATATCAGGG - Intronic
1073008010 10:100339462-100339484 GGGCATGGGAGGAGCCATGATGG - Intergenic
1074781038 10:116802620-116802642 AGGCATGGTGGGAGACGCCAGGG + Intergenic
1075974852 10:126686180-126686202 TGAGGTGGTGGGAGACATCATGG - Intergenic
1076758931 10:132590356-132590378 GGACAGTGTGGGGGACATCATGG - Intronic
1076979515 11:197215-197237 GAGCAGGGTCGGGGACATCAGGG + Intronic
1077093175 11:788655-788677 GGGCCTGGAGGGAGACACAAGGG + Exonic
1078194280 11:9121985-9122007 GGGCATGGTGGAAATCATAATGG - Intronic
1078398836 11:11005550-11005572 GGGCATGGTGGCAGACGTGGAGG + Intergenic
1078505055 11:11932271-11932293 GGGCCTGGTGGGAGATGTCTGGG - Intronic
1078535783 11:12172529-12172551 AAACAAGGTGGGAGACATCATGG + Intronic
1078831461 11:14981025-14981047 GGACTTGGTGGGTGACGTCAAGG + Intronic
1079137442 11:17783867-17783889 TGCCATGCTGGGAGGCATCAAGG - Intergenic
1079363825 11:19792026-19792048 GGGCATGGTGGGGGAGAGAAGGG + Intronic
1082167175 11:48963268-48963290 GGGCATGCTGGGAGCTACCAAGG - Intergenic
1082236402 11:49823431-49823453 GGGCATGCTGGGAGCCACCAAGG + Intergenic
1082239852 11:49857938-49857960 GGGCATGCTGGGAGCCACCAAGG + Intergenic
1082242297 11:49886413-49886435 GGGCATGCTGGGAGCCGCCAAGG - Intergenic
1082609891 11:55283307-55283329 GGGCATGCTGGGAGCCGCCAAGG + Intergenic
1082656793 11:55867217-55867239 GGGCATGCTGGGAGGCGCCAAGG - Intergenic
1083655596 11:64227684-64227706 GGACAGGGTGGTAGACATGAAGG + Intronic
1083730166 11:64648532-64648554 GGCCAGGGTGTGAGACAACAGGG + Intronic
1083742313 11:64717419-64717441 GGGCAGGGTGGGAGGCACTAGGG - Intronic
1083895449 11:65617597-65617619 GGCCATGGTTGCAGACATCAAGG + Exonic
1084489328 11:69469861-69469883 GGGCATGGTGGCACACACCTGGG - Intergenic
1084563046 11:69914822-69914844 GGGCATGGAAGGAGACAGCAGGG - Intergenic
1086046642 11:82540494-82540516 GGGCAGGGTTGGAGAGATGATGG + Intergenic
1086246340 11:84757760-84757782 TGGCATGGTGGGAAACATACAGG - Intronic
1088577621 11:111286992-111287014 GGGCATGGTGGCATACACCTGGG - Intergenic
1089202649 11:116733683-116733705 GGCCATGGTGGGAGGAAGCATGG - Intergenic
1089389449 11:118090319-118090341 GTGCATTGTAGGAGACATCAGGG + Intronic
1089821231 11:121228080-121228102 GGGCCTGGTGGGAGGCATTTGGG - Intergenic
1090395141 11:126413969-126413991 GGGCCTCTTGGGAGACATTATGG - Exonic
1092508476 12:9128027-9128049 GAGCTTGGAGGCAGACATCAAGG + Intergenic
1093806494 12:23439348-23439370 AGGCATGGTCAAAGACATCATGG + Intergenic
1094408079 12:30140019-30140041 GGGCCTGGTGGGAGATGTCTGGG + Intergenic
1094427045 12:30326963-30326985 GGCCATGGTGGGAGAGATGGAGG - Intergenic
1097882177 12:64696054-64696076 AGGTAGGGTGGGAGACAGCAGGG - Exonic
1099401089 12:82204530-82204552 GGTCATGGTGGCAGGCATGAAGG - Intergenic
1099477195 12:83121983-83122005 GGGCATGGTGGGAGTCAGACCGG - Intronic
1099651960 12:85439907-85439929 GGGCATGTTGGGATTCATCAAGG - Intergenic
1101827775 12:108233813-108233835 GGGCATGGTGGGAGACATCAGGG + Intronic
1102465559 12:113129162-113129184 GGACATGGTGGGAGAAGTCCTGG + Intronic
1102495751 12:113318674-113318696 GAGAATGGTGGGAAACATCAGGG + Intronic
1102998551 12:117367754-117367776 GGGCTGGGTGGGAGACATCAGGG + Intronic
1103379203 12:120480717-120480739 AGGCATAATGGGAGACAACAAGG - Intronic
1104357363 12:128099625-128099647 GGTCATGAAGGGAGCCATCATGG - Intergenic
1104625527 12:130351044-130351066 AGGCATGGTTGGAGTCCTCAAGG - Intronic
1105286848 13:19011626-19011648 GGGCAGGGTGGGTGACAGTAGGG + Intergenic
1106913534 13:34487983-34488005 GGGGAGGTTGGGAGTCATCAAGG + Intergenic
1107127826 13:36863574-36863596 GGGCTTGGTGGGAGGTATCTGGG + Intronic
1108813513 13:54261992-54262014 GGGCCTGGTGAGAGACACTAGGG + Intergenic
1109528691 13:63610282-63610304 GAGCATGTTGTGAGCCATCAAGG - Intergenic
1114070343 14:19100200-19100222 GGGCGGAGTGGGAGACACCACGG - Intergenic
1114091918 14:19299802-19299824 GGGCGGAGTGGGAGACACCACGG + Intergenic
1115110626 14:29817217-29817239 GGGCATGCTGTGAGTGATCAGGG + Intronic
1115502985 14:34065664-34065686 GGGTATGGTGGGAGGACTCAGGG - Intronic
1115680290 14:35730544-35730566 GGGCATGGTGGGAGACAGACTGG + Intronic
1115855654 14:37627005-37627027 GGTCATGGTGGGATCCCTCATGG + Intronic
1116199526 14:41773151-41773173 GGGCATGATGGGGGACAACTTGG - Intronic
1117288805 14:54312609-54312631 GGGCATGTGGGGAGCCATCCTGG - Intergenic
1117855251 14:60024493-60024515 GGACATGTGGGGAGACATCGAGG + Intronic
1118385186 14:65250430-65250452 GGCCATGGTGGCAGAGATGAAGG - Intergenic
1118471632 14:66079966-66079988 GGGCATGGTGCTACAGATCAAGG - Intergenic
1118864090 14:69689051-69689073 GAACATGGTGGGGGACATAAAGG - Intronic
1119802291 14:77456982-77457004 AGGCAGGGTGAGAGACCTCAGGG + Intronic
1120690681 14:87589287-87589309 GGGTATAGTAGGAGACATGAGGG - Intergenic
1121220189 14:92279193-92279215 GTGCATGGTGGGACACCCCAGGG + Intergenic
1121919716 14:97869249-97869271 GGGCACTGTGGGAGACAAGATGG - Intergenic
1121949281 14:98156316-98156338 AGGCATCGTGGGAGACCGCAGGG + Intergenic
1122214066 14:100192151-100192173 GGGCGGGGTGGGAGAAGTCAGGG + Intergenic
1124015110 15:25867137-25867159 GGGGATGCTGGGAGACACCTGGG + Intergenic
1124233678 15:27968355-27968377 GGGCAGGGTGGGAGGGACCACGG + Intronic
1125773206 15:42186305-42186327 GAGCATGGTGGTAGGCATCTGGG + Intronic
1127325842 15:57894605-57894627 GGTGATGATGGGAGTCATCAAGG - Intergenic
1127832299 15:62761662-62761684 GGGCCTGATGGGAGAAAACAGGG - Exonic
1128512069 15:68319448-68319470 GGCCATGGTGGGAACCAGCAGGG + Intronic
1128524538 15:68403327-68403349 GGGCATGGTGGGAGATGTTTGGG + Intronic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1130002794 15:80061436-80061458 GGGTTTGGGGGGAGTCATCAAGG - Intronic
1130053907 15:80506492-80506514 GTGCAGGGTGGTAGATATCAAGG + Intronic
1130668107 15:85886671-85886693 GGGAATGGTCAGGGACATCAGGG - Intergenic
1130909379 15:88260661-88260683 GGGCATGGTGGGTGAATCCATGG - Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1134280643 16:12813876-12813898 GGGCATGGTGGTTCACATCTGGG + Intergenic
1134880921 16:17745061-17745083 GGGCTCGGTGGGAAACCTCACGG - Intergenic
1136013018 16:27376865-27376887 GGGCATGATAGGAGACATACAGG - Intergenic
1136508625 16:30722409-30722431 GGGCATGGTTGGAGGGATCTTGG + Intronic
1137530883 16:49278119-49278141 GGACGCGGTGGGAGACATCCGGG + Exonic
1137724736 16:50649591-50649613 GGGACTGATGGGAGACAGCATGG - Intergenic
1138526206 16:57608831-57608853 GGGCAGGGTGGGAGACAATAGGG - Intergenic
1140410997 16:74740225-74740247 GGGCAGGGTGGTGGAGATCAAGG + Intronic
1141716168 16:85728391-85728413 GGGCTTGGTGGGAAAGATGAAGG - Intronic
1142066749 16:88067323-88067345 GGGCATGGGGCGAGACACCTGGG - Intronic
1142222887 16:88864178-88864200 GGCCATGGTGGAGGGCATCAGGG - Intronic
1142287417 16:89177078-89177100 GGGCAGGGTGGGAGGCTTCCAGG - Intronic
1142803745 17:2361004-2361026 GGGCTTGGTAGGAGACAGTAGGG - Intronic
1143681988 17:8482416-8482438 GGGCAGGGTGGGAGTCAGGAAGG + Intronic
1143874401 17:9980948-9980970 GGGCCTCTTGGGAGACATCTAGG - Intronic
1143926162 17:10372824-10372846 GGGCAAGGTTGGAGACAAGATGG - Intronic
1144124980 17:12194877-12194899 GGGCATGGTGACAGACAGCATGG - Intergenic
1144498500 17:15765377-15765399 GGGCATGGTGGCAAACATGGAGG + Intergenic
1145161882 17:20580418-20580440 GGGCATGGTGGCAAACATGGAGG + Exonic
1145774565 17:27519051-27519073 GGGCATGGTGAGAGGAACCAGGG - Intronic
1145900976 17:28490396-28490418 GGGCACCGTGGGAGACTCCAGGG + Exonic
1146644865 17:34570727-34570749 GGGCCTGGTGGGAGGGGTCATGG - Intergenic
1147911929 17:43861186-43861208 GGGGATGGTGAGAGACCCCATGG - Intronic
1148184640 17:45633286-45633308 GGAGATGGTGGGAGATATTATGG - Intergenic
1148587092 17:48788623-48788645 GGGCATGGTGGAAGGCATCCTGG + Intronic
1148856430 17:50581489-50581511 GGGGATGGTGGGAGAGGACAGGG - Intronic
1149456852 17:56794986-56795008 GGGAGTGGTGGGGGACAGCATGG - Intronic
1151258604 17:72899229-72899251 GGGCAAGGTGGGGTACAGCAGGG - Intronic
1151920105 17:77148209-77148231 GGGCAGGGTGGGAGAGGTCAAGG + Intronic
1152252381 17:79218767-79218789 GGGACTAGTGGGACACATCAGGG + Intronic
1152258166 17:79252299-79252321 GAGCAGTCTGGGAGACATCAAGG - Intronic
1154347890 18:13558861-13558883 GGGCTGGGTGGGAGAATTCAAGG - Intronic
1154958862 18:21287943-21287965 GGGCATGGTGGTAGATTACAGGG - Intronic
1155521685 18:26674726-26674748 GGACAGGGTGGGAGACTTGAGGG - Intergenic
1156604498 18:38650318-38650340 GGGCAAGGTTGGAAAAATCAGGG - Intergenic
1156954356 18:42943489-42943511 AGTCATGGTGGGATAAATCAAGG - Intronic
1157109553 18:44807831-44807853 GGGCATGGTGGTATAGATGATGG + Intronic
1157957216 18:52111919-52111941 GGGCTTCTTGGGAGACCTCAGGG + Intergenic
1158331544 18:56368197-56368219 GGGCATGGTGGGAGTGAGAATGG - Intergenic
1159262005 18:66026261-66026283 GGGCCTGGTGGGAGATATATGGG + Intergenic
1159434245 18:68395356-68395378 GGGCCTGGTGGGAGATGTCTGGG - Intergenic
1159931338 18:74315749-74315771 GGGCATGCTGGGAGAGCGCAGGG + Intergenic
1161220370 19:3115617-3115639 GGGCCTGGTTGGAGCCAGCATGG + Intronic
1161266906 19:3368309-3368331 GGGCTGGTTGGGAGACATCCTGG + Intronic
1161324376 19:3656280-3656302 GGGCGTGGTGAGAGGCATCTTGG - Intronic
1161571472 19:5033025-5033047 GGCCAAGGTGGGTGACATCCTGG + Exonic
1162783367 19:13018802-13018824 GGACAAGGTGGGAGAGCTCAGGG + Intronic
1164304979 19:23998178-23998200 TGGCATGGTGAGAGCCATCTTGG + Intergenic
1164648349 19:29874651-29874673 GGATATGGGGGGAGACCTCAAGG - Intergenic
1164886608 19:31783733-31783755 GGGCCTGGTGGGAGACGGCAGGG - Intergenic
1165824726 19:38699189-38699211 GGGCATGCTCATAGACATCAGGG - Intronic
1166374004 19:42316838-42316860 GGCCATGAGGGGAGACAGCAGGG - Intronic
1166702329 19:44889254-44889276 GGGGATGGGGTGAGACATGAAGG + Intergenic
1167500586 19:49844756-49844778 GGGCGTGGTGGCAGGCATCTGGG + Intergenic
925881377 2:8355597-8355619 GGGCATGGTGGGAAAGTTCCTGG + Intergenic
927343537 2:22010017-22010039 GGGCCTGGTGGGAGGCATTTAGG + Intergenic
927459393 2:23284942-23284964 GGGCAAGGGGAGGGACATCAAGG - Intergenic
928044962 2:27921528-27921550 GGCCATGGAGGCAGACATCCTGG + Intronic
929509634 2:42556578-42556600 GGGCAGGCTGGGAGACTTGAGGG - Intronic
929769987 2:44883661-44883683 GGTCAGGGAGGGAGACACCATGG - Intergenic
930118465 2:47740196-47740218 GGGCCTGGTGGGAGGCATTTGGG - Intronic
931064798 2:58573285-58573307 GGGCATGGGGGGAGAGCTCCTGG + Intergenic
932235141 2:70114961-70114983 GGGCATGGTGGTACACACCTAGG - Intergenic
932304283 2:70690884-70690906 GGGCATTGTGGGAGACAGGCAGG + Exonic
932592994 2:73078399-73078421 GGTCATGCTGGCAGACAGCAGGG + Intronic
932801823 2:74747951-74747973 GGGCATGGTGGGAGACCGAGAGG - Intergenic
933370854 2:81413550-81413572 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
935026133 2:99278575-99278597 GTTCTTGGTTGGAGACATCAGGG + Intronic
937305169 2:120866575-120866597 GGGGATGGCAGGAGACATAATGG - Intronic
939275701 2:139993392-139993414 GGACATGTTGGGATTCATCAAGG - Intergenic
940322322 2:152390227-152390249 GGACATGGTGGTGGACATCCAGG + Intronic
941431736 2:165422213-165422235 GGGCCTGGTGGGAATCATAATGG - Intergenic
942064026 2:172253472-172253494 GGGCATGGCGGGAGGCAGCCTGG + Intergenic
942174979 2:173324834-173324856 GGCCAAGCAGGGAGACATCATGG - Intergenic
942364718 2:175212770-175212792 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
943845666 2:192643494-192643516 AGGTATGGTGGTAGAAATCAGGG + Intergenic
944211992 2:197216054-197216076 GGGCATAGTTGGAGCCAGCAAGG - Intronic
944487202 2:200219338-200219360 GATCATGGTGGGAGACAAAATGG + Intergenic
946356498 2:219188996-219189018 TGGCATGGTGAGGGATATCAGGG - Intergenic
947058414 2:226134263-226134285 GGGCAAGGTAGAAGACATCCAGG + Intergenic
947563340 2:231177206-231177228 AGCCCTGGTGGGAGAAATCATGG - Intergenic
947593507 2:231397535-231397557 GGGCAGGGTGGGAGAAAGAAAGG + Intronic
948305684 2:236945180-236945202 GGACAGGGTGGGGGACTTCATGG + Intergenic
948315550 2:237025965-237025987 GGTCATCGTTGGAGTCATCAGGG - Intergenic
948739312 2:240032600-240032622 GGGTATGATGTTAGACATCAGGG + Intergenic
1170295276 20:14818164-14818186 AGGCATGGAGGCAGACACCAGGG + Intronic
1172274476 20:33672344-33672366 GGGCAGGGTGGGAGGCATCCAGG - Intronic
1172854683 20:37992871-37992893 GGGCATGCCGGGAGACATCCTGG + Intronic
1173464006 20:43267101-43267123 TGACATTGTGGGAGAAATCATGG - Intergenic
1174448954 20:50608429-50608451 GGTCATCGTGGTGGACATCACGG - Exonic
1175212141 20:57366563-57366585 GGGCCTGGTGGGAGATGTCTGGG - Intronic
1175476200 20:59276447-59276469 AGGCAATCTGGGAGACATCATGG + Intergenic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1176254710 20:64145938-64145960 GGACATGGAGGGAGACATTTCGG - Intergenic
1177153058 21:17473846-17473868 GGGCCTGGTGGCAGACATTTTGG + Intergenic
1178360220 21:31942943-31942965 AGGCATGGAGGGAGAGATGAAGG + Intronic
1178813235 21:35903929-35903951 AGGCATGGTGGGAGGCATGATGG - Intronic
1180488815 22:15822762-15822784 GGGCGGAGTGGGAGACACCACGG - Intergenic
1180916346 22:19490966-19490988 GGGCATGGTGGCACACACCTGGG - Intronic
1181419164 22:22785926-22785948 GGGCACAGTGGGAGACATGGAGG - Intronic
1182319044 22:29466417-29466439 GGGCAAGCTGGGAGTCAGCAGGG - Intergenic
1182435154 22:30325785-30325807 GGGCAGGCAGGGAGACAGCAGGG - Intronic
1183661771 22:39225499-39225521 GGGCATGCTGGGACACAGCTGGG + Intronic
1184212374 22:43043606-43043628 GGGCATGGTGGGTGCGATGATGG - Intronic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1184916545 22:47573043-47573065 GGGCTTCCTGGGAGACAGCAGGG - Intergenic
949171151 3:998703-998725 AGGCATCTTGGAAGACATCAAGG - Intergenic
950098296 3:10342776-10342798 GGGCAAGCTGGTAGACAGCATGG + Exonic
952904380 3:38129909-38129931 GGGCATGGTGGCAGGCGCCAGGG + Intronic
953493393 3:43367610-43367632 GGGCAGGATGGGAGACTTCCAGG + Intronic
954325670 3:49862000-49862022 GGGCGGGGTGGGAGGCAGCAGGG - Intronic
954671156 3:52292019-52292041 GGGCATGGTGTGAAAGACCATGG + Intronic
954671163 3:52292041-52292063 GGGCCGGCTGGGTGACATCATGG + Intronic
955088275 3:55724272-55724294 GGTCATGGCGGGAGCCAGCAGGG + Intronic
957436315 3:80181607-80181629 GGGCATGGTGGGAAAAATGAAGG + Intergenic
958038750 3:88200872-88200894 GGGCCTGGTGGGAGATATTTGGG - Intergenic
959513960 3:107244884-107244906 GGGCATGCAGAGAGACACCAGGG - Intergenic
959899023 3:111639289-111639311 GGGCATGGTGGGAGTGAGAATGG + Intronic
960134139 3:114088851-114088873 GGGCCTGGTGGGAGGTATCTGGG - Intergenic
961367259 3:126407917-126407939 GGGCAGAGCGGGAGACAGCAGGG - Intronic
961466243 3:127083579-127083601 GGGCATGGTGGGAGGTGTCTGGG + Intergenic
962215438 3:133516908-133516930 GGACATGCAGAGAGACATCAGGG - Intergenic
962753778 3:138452942-138452964 GGGCATGGTAGCACACACCAGGG + Intronic
962778758 3:138690768-138690790 AGGCATGGAGGGACACATAAGGG + Intronic
963209459 3:142673185-142673207 GGGCATGGTGGTACACATTTGGG - Intronic
964458327 3:156893489-156893511 GGGCCTGGTGGGAGATATTTAGG + Intronic
965006402 3:163031868-163031890 GGCCATGGTGGCAGACAAGAAGG - Intergenic
967113612 3:186317579-186317601 GGGCAGGGTGGAGGACATCATGG - Intronic
967335567 3:188340263-188340285 GGGAATGGTTTGAGACATAATGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
970028178 4:11646774-11646796 GAACATTGAGGGAGACATCATGG - Intergenic
971972085 4:33633885-33633907 GGGCCTGGTGGGAGGCCCCATGG + Intergenic
973020534 4:45200170-45200192 GGCCATGGTGGCAGACATCAAGG - Intergenic
973060509 4:45718383-45718405 GGGAATGGTGGCAGAGATGAAGG + Intergenic
974003335 4:56531925-56531947 TGGAATGGTGGAAGACATAAGGG - Intronic
976835687 4:89370485-89370507 GAGCAAGGTGGGAGACCTCAAGG + Intergenic
977236728 4:94516669-94516691 GGGCATGGTGTGTGCCATCTGGG - Intronic
978141077 4:105318058-105318080 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
979175114 4:117652649-117652671 GGCCATGTTGGGATTCATCAAGG - Intergenic
980063305 4:128155385-128155407 GGGCATGTTCTGAGACTTCAGGG + Intronic
980194066 4:129565270-129565292 GAGTTTGGTGGGGGACATCAGGG + Intergenic
980877719 4:138678784-138678806 GGGCATGGTGAGAAACAAGAGGG + Intergenic
981987480 4:150875225-150875247 CGGAATGGTGGGACACCTCAGGG - Intronic
984841289 4:184070074-184070096 GGGCCTGGTGGGAGGCAACTGGG + Intergenic
985346998 4:189016708-189016730 GGTCATGGTCTGAGACTTCAAGG - Intergenic
986454178 5:7899175-7899197 GGGCTTGGTGGGAGGCGTCTGGG - Intronic
987694540 5:21311027-21311049 GGGAAATGTGGGTGACATCAGGG + Intergenic
989782844 5:45290029-45290051 GGACCTGGTGGGAGAAATCATGG + Intronic
991071908 5:62492681-62492703 GGGCATGGTGGCACACATCGTGG - Intronic
991265786 5:64715500-64715522 GGGCAGAGAGGGAGACACCAGGG + Intronic
991745700 5:69738444-69738466 GGGAAATGTGGGTGACATCAGGG - Intergenic
991752006 5:69816789-69816811 GGGAAATGTGGGTGACATCAGGG + Intergenic
991797300 5:70318401-70318423 GGGAAATGTGGGTGACATCAGGG - Intergenic
991825078 5:70613758-70613780 GGGAAATGTGGGTGACATCAGGG - Intergenic
991831293 5:70691691-70691713 GGGAAATGTGGGTGACATCAGGG + Intergenic
991889645 5:71317729-71317751 GGGAAATGTGGGTGACATCAGGG - Intergenic
992501322 5:77347090-77347112 GGGCATGGAGGAAGACAGGAAGG - Intronic
992781594 5:80133000-80133022 GGGCCTGGTGGGAGGTGTCATGG + Intronic
995911489 5:117193081-117193103 GGGCCTGGTGGGAGATATTTGGG + Intergenic
996930012 5:128874974-128874996 GGGCCTGGTGGGAGCCATTTTGG + Intronic
997110102 5:131065489-131065511 GGGCCTGGTGGGAGATCACAGGG + Intergenic
997965047 5:138350115-138350137 AGGCAGGGTGGGAGACAGCCAGG + Intergenic
998054452 5:139062508-139062530 GGGTATGGTGGGAGCTGTCAGGG - Intronic
1000838048 5:166180175-166180197 GGGCAAGGCCGCAGACATCATGG - Intergenic
1002212179 5:177605607-177605629 GGGGATGGTGGGAGTCAGCCCGG - Intronic
1004305011 6:14492746-14492768 GGGCAGGGAGGAAGAAATCATGG - Intergenic
1004322732 6:14645364-14645386 GGGCATGGAGGGGGAAACCAAGG + Intergenic
1005556363 6:26988911-26988933 GGGAAATGTGGGTGACATCAGGG - Intergenic
1005574097 6:27176074-27176096 GTGCGTGGTGGGAGACAGGAGGG - Intergenic
1010798876 6:80150316-80150338 GGGCATCGTGGGAGACAAGAAGG - Intronic
1011119940 6:83941623-83941645 GAGGATGATGGGAGACAGCAGGG - Intronic
1011472448 6:87721517-87721539 GGGCATGGTGGAATGCATCCTGG - Intergenic
1012866399 6:104623298-104623320 GGGCAGGGAGGGAGAGAGCAAGG + Intergenic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1015670771 6:135687342-135687364 AGGCAAGGTTGGAGACCTCAGGG - Intergenic
1019062217 6:169264773-169264795 CAGCATGGTGGGAGAGAGCAGGG + Intergenic
1019115680 6:169760143-169760165 GGGCATGGTGGGAGGAGGCAGGG - Intronic
1020185338 7:5954659-5954681 TGACATGGTGGGAGATATCGTGG + Intronic
1020297575 7:6770086-6770108 TGACATGGTGGGAGATATCGTGG - Intronic
1020809146 7:12830099-12830121 GGGCCTGGTGGGAGATGTCTGGG - Intergenic
1022227248 7:28376016-28376038 GGGCATGGTGGGAGACAAGATGG - Intronic
1022770966 7:33472532-33472554 GGGCATGATGGTAGATAACATGG + Intronic
1023890259 7:44386821-44386843 GGCCATGGCAGGGGACATCAGGG + Intronic
1024178626 7:46865181-46865203 GGGCATGGTGGGAGATATTTGGG - Intergenic
1024238567 7:47416040-47416062 GGCCATGGTGAGGGACCTCAGGG - Intronic
1024432181 7:49301758-49301780 GGGGCTGGTGAGTGACATCAGGG + Intergenic
1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG + Intergenic
1025874825 7:65471211-65471233 GGGCATGGTGGCTCACACCAAGG + Intergenic
1026110524 7:67455485-67455507 GAGCAAGGAGGAAGACATCAGGG - Intergenic
1026269250 7:68822197-68822219 GGGCACTGGGGTAGACATCAGGG - Intergenic
1028435498 7:90798427-90798449 GGGCAATGTGGGAGACATTTGGG + Intronic
1029245020 7:99193019-99193041 CGGCAGGGTGGGTGAAATCAAGG + Exonic
1029246426 7:99205284-99205306 GGGCATGGTGGTACACACCATGG + Intronic
1029471705 7:100758714-100758736 GGGCATGGTGGGTGGCAGGAAGG + Intronic
1031147278 7:118010695-118010717 GGGCCTGGTGGGAGGTATCTGGG - Intergenic
1032389130 7:131544435-131544457 GGGCAGGGTGGGAGCCGTCCTGG - Intronic
1034531463 7:151698438-151698460 GGGCCTGGTGGGAGAAGTCTGGG + Intronic
1034975029 7:155443303-155443325 GGGTATGGTGGGTGGCTTCAGGG - Intergenic
1038278502 8:26141753-26141775 GGGCCTGGTGGGAGATATTTGGG + Intergenic
1039313733 8:36348883-36348905 GGGCTTGGAGGGAGAGATAATGG + Intergenic
1040029741 8:42813642-42813664 GGGCCTGGTGGGAGATATTTCGG + Intergenic
1040700902 8:50064406-50064428 AGTGATGGTGGGAGCCATCAAGG - Intronic
1042466732 8:69136542-69136564 GGCCATTGTGGGAGACAGCAGGG + Intergenic
1042540309 8:69901435-69901457 AGGGATGATGGGAGATATCAAGG + Intergenic
1043057414 8:75456879-75456901 GGGCATGGTGGCACACGTCTGGG - Intronic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1045514448 8:102845118-102845140 GGGGGTGGTGGGAGGAATCAAGG - Intronic
1045671892 8:104564546-104564568 GGGCAGGGAGGGAGTAATCAGGG + Intronic
1046056773 8:109087626-109087648 GGGCATTGTAGGCAACATCATGG + Exonic
1046286026 8:112093173-112093195 GGTCATGTTGGGATTCATCAAGG - Intergenic
1046372149 8:113324268-113324290 GGGCATGTTGGAAGACTTCACGG + Intronic
1046888512 8:119396048-119396070 GGGCATGGTGGTTAAAATCATGG - Intergenic
1047547907 8:125838309-125838331 GGACATGTTGGGATTCATCAAGG + Intergenic
1047708259 8:127524139-127524161 TGGCATGATGATAGACATCATGG - Intergenic
1051504452 9:17812181-17812203 GGGCATGGTGGGAGACGAGATGG + Intergenic
1052603593 9:30671248-30671270 GGGCACAGTGGGAGCCATGAAGG - Intergenic
1056597936 9:88022981-88023003 GGGCGTGGTGGGAGGTGTCACGG + Intergenic
1057353393 9:94317990-94318012 GTGGATGGTGGGAGGGATCAGGG + Intergenic
1057654358 9:96939602-96939624 GTGGATGGTGGGAGGGATCAGGG - Intronic
1062121508 9:134836398-134836420 GGGCCTGGTGGGAGGCGTCTGGG - Intronic
1062228233 9:135465856-135465878 GGGAAGGGTGTGAGACATCTGGG - Intergenic
1062598972 9:137311653-137311675 GGGCCTTGTGGGTGACAGCAAGG - Intronic
1185913961 X:4014191-4014213 GGGCCTGGTGGGAGACGTTTGGG + Intergenic
1186629963 X:11338111-11338133 GGGCATAGTGGGAGATGTCTGGG - Intronic
1186645801 X:11506114-11506136 GAGAATCGTGGGAGACTTCAGGG - Intronic
1187425084 X:19170465-19170487 GGGCATTGTGGGAGACAGGCTGG - Intergenic
1187633527 X:21201743-21201765 GGGCCTGGTGGGAGATATTTGGG - Intergenic
1187643453 X:21319569-21319591 GGGCATGTTGGAAGTCTTCACGG - Intergenic
1188585393 X:31768321-31768343 AGGGATGGTGGGAGACAGGAGGG - Intronic
1188705098 X:33318570-33318592 GGGCATGGTGGCACACTTTAGGG - Intronic
1189887590 X:45564019-45564041 TGACAGGATGGGAGACATCATGG + Intergenic
1191257226 X:58284859-58284881 GGGCATGGTGGCAGCCAGGAAGG + Intergenic
1191953028 X:66615194-66615216 AGGCATGGTTGTAGACACCATGG - Intronic
1192439918 X:71166818-71166840 AGGGATGGTGGAAGCCATCAAGG + Intronic
1193541287 X:82775582-82775604 GGGCATGGTGGGAGTCAGACCGG - Intergenic
1193839231 X:86388423-86388445 GGGCAAAATGGGAGACATGAGGG - Intronic
1194894628 X:99425476-99425498 GAGCATGGTGGCATACACCATGG + Intergenic
1199220889 X:145314583-145314605 GGGCATGGTAGGAGTCATGAGGG - Intergenic
1199613397 X:149636116-149636138 GGGCATAGTGGGAAGCATCATGG - Intergenic