ID: 1101829077

View in Genome Browser
Species Human (GRCh38)
Location 12:108243087-108243109
Sequence CTCAAACTCAAGTGTCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101829077_1101829085 23 Left 1101829077 12:108243087-108243109 CCCTGGAGACACTTGAGTTTGAG 0: 1
1: 0
2: 7
3: 39
4: 274
Right 1101829085 12:108243133-108243155 CAGTGGCATCAGCATCCCTTGGG 0: 1
1: 5
2: 21
3: 145
4: 764
1101829077_1101829082 6 Left 1101829077 12:108243087-108243109 CCCTGGAGACACTTGAGTTTGAG 0: 1
1: 0
2: 7
3: 39
4: 274
Right 1101829082 12:108243116-108243138 GCTTTAAGGTCCTGAATCAGTGG 0: 1
1: 0
2: 1
3: 9
4: 89
1101829077_1101829079 -8 Left 1101829077 12:108243087-108243109 CCCTGGAGACACTTGAGTTTGAG 0: 1
1: 0
2: 7
3: 39
4: 274
Right 1101829079 12:108243102-108243124 AGTTTGAGACCCTTGCTTTAAGG 0: 1
1: 0
2: 2
3: 28
4: 194
1101829077_1101829084 22 Left 1101829077 12:108243087-108243109 CCCTGGAGACACTTGAGTTTGAG 0: 1
1: 0
2: 7
3: 39
4: 274
Right 1101829084 12:108243132-108243154 TCAGTGGCATCAGCATCCCTTGG 0: 1
1: 1
2: 11
3: 79
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101829077 Original CRISPR CTCAAACTCAAGTGTCTCCA GGG (reversed) Intronic
900568473 1:3346948-3346970 CTGACACTCAGGTGTCCCCAGGG - Intronic
901343202 1:8514328-8514350 TTCTAACTCAAATGTCTCGACGG + Intronic
902140471 1:14349634-14349656 CTCAAACTCAAATGTCTATAGGG - Intergenic
902142445 1:14367874-14367896 ATCAAACTGAAAAGTCTCCAAGG - Intergenic
902301358 1:15504955-15504977 GTCAAACTCATGTGCCTCTAGGG + Intronic
903379950 1:22889765-22889787 CAAAAACTCAAGAGTGTCCATGG + Intronic
905224847 1:36472356-36472378 CTCATACTGAAGGGCCTCCAAGG + Exonic
908560855 1:65304758-65304780 CTCAAACTCAAATGCCTGCAAGG + Intronic
908686994 1:66731819-66731841 TGCAAACTGAAATGTCTCCAGGG - Intronic
908725314 1:67169768-67169790 TGCAAACTCAAATGTCTCCAGGG + Intronic
909447469 1:75764178-75764200 CTCAAATTCAATAGTTTCCATGG + Intronic
910529405 1:88218430-88218452 CTCAAGCTCCAGTTTCTCTATGG + Intergenic
912454028 1:109785932-109785954 CCTAAACTCAATTGTCTGCAGGG + Intergenic
915197252 1:154198761-154198783 TCCAAACTTAAATGTCTCCAGGG - Intergenic
915259854 1:154669637-154669659 CTCAATCTCAAGTGCCTGAAAGG - Intergenic
915620160 1:157077135-157077157 CTCAAACTCAAAGGCCTACAGGG - Intergenic
915765935 1:158362585-158362607 CTTAAACACAAGTGTCACCTGGG + Intergenic
916026082 1:160834775-160834797 TTCAAACCCAAGACTCTCCAGGG + Intronic
916169406 1:161989309-161989331 CTCAAACTCAGATGCCTACAGGG + Intronic
917960633 1:180141561-180141583 CCCAAATCCAAGTGTCTTCAGGG - Intergenic
918305764 1:183244649-183244671 CCAAAACTCAAGTGCCCCCATGG - Exonic
918548643 1:185714091-185714113 CTCAAAGTCATCTGACTCCAGGG + Intergenic
920887281 1:209941826-209941848 CTTAAATTTTAGTGTCTCCAGGG - Intronic
921129130 1:212204634-212204656 TGCAAACTCAAATGCCTCCAGGG + Intergenic
922408603 1:225345272-225345294 TTCAAACTAAAATGTGTCCAAGG + Intronic
922576637 1:226665252-226665274 CTCAAACTCAAATGCCACCAGGG - Intronic
922849201 1:228718086-228718108 CTCTAATTTAAGTGTCCCCAAGG - Intergenic
923279835 1:232432807-232432829 CTCAAACTCAGTTGTCTCCAGGG + Intronic
924817254 1:247453310-247453332 CTCAAACTCCAGGGTTTCAATGG + Intergenic
1066243559 10:33560971-33560993 CTCAACCCCAAGTGTCCCCTTGG - Intergenic
1067340728 10:45401168-45401190 CACAGACTCAAATGTTTCCAGGG - Intronic
1068420304 10:56782667-56782689 CTGAAACTAAAGTGTCAGCAGGG + Intergenic
1068579914 10:58727785-58727807 CTAAACCTGCAGTGTCTCCAAGG - Intronic
1068829789 10:61480353-61480375 CCAAAACTCAAGTGTATTCAGGG + Intergenic
1069637537 10:69934873-69934895 CTCAAACTCAAATGTCTACAAGG + Intronic
1070375552 10:75827667-75827689 CTCAAACTCAAGTCTTTCTTTGG - Intronic
1070645717 10:78200853-78200875 CCCAAACTCAAGTGCCTGCTGGG - Intergenic
1071363996 10:84880160-84880182 CAAAAACTCAAATGGCTCCAGGG + Intergenic
1072800405 10:98388779-98388801 CCCAAACGCAAATGTCTCGAAGG + Intronic
1074849750 10:117430195-117430217 ATAAAACACAAGTGGCTCCATGG - Intergenic
1074881278 10:117661487-117661509 CACAAAATCAAATGCCTCCAGGG + Intergenic
1075745953 10:124727682-124727704 CTCAAACTCAAATGCCTTCCAGG + Intronic
1079280767 11:19085085-19085107 TTCAAACTCCTGTGTTTCCAAGG + Intergenic
1079358987 11:19754615-19754637 CTCCAGCTCATGTGTCTGCATGG + Intronic
1079818545 11:25094552-25094574 CTCAACCTCAGGTGTCCCCAGGG + Intergenic
1081515431 11:43824242-43824264 CCCAAACTCAAGTGCCTGAAAGG - Intronic
1083484130 11:62972509-62972531 CCCAAACTTAAGTGTCTACAAGG + Intronic
1084469239 11:69345942-69345964 CTCAAACTGTAGTGTCTCCGTGG - Intronic
1087577361 11:100005973-100005995 CTGAACCTCAAATATCTCCAAGG - Intronic
1088227400 11:107636378-107636400 CCCAAACTCAAGTGTTTTGAGGG - Intronic
1088440295 11:109863140-109863162 CATAAACTCAAATGTCTACAGGG - Intergenic
1089385412 11:118064224-118064246 CTCAAACTCAATTTTCCCCTTGG - Intergenic
1089926058 11:122258961-122258983 CTCTAACTCAACTGGCTCTAGGG + Intergenic
1092967809 12:13661646-13661668 TGCAAACTCCAGTGTCTGCAGGG + Intronic
1098775206 12:74604331-74604353 CTCAAATTCAAATGTTTTCAGGG + Intergenic
1099003351 12:77207239-77207261 CTCAAGCTAAAGTGTTGCCAAGG + Intergenic
1099516360 12:83600912-83600934 ATCAAACTCAGTTGTTTCCATGG + Intergenic
1099833095 12:87870743-87870765 CTCACACTCAAATATCTGCAGGG - Intergenic
1100406011 12:94273426-94273448 CTGGAAGCCAAGTGTCTCCATGG + Intronic
1100689822 12:97027905-97027927 CTCAACCTCAAATGTATTCAGGG - Intergenic
1101829077 12:108243087-108243109 CTCAAACTCAAGTGTCTCCAGGG - Intronic
1101927483 12:108984599-108984621 CTCAAACTCAAATGTCTACAGGG - Intronic
1102008851 12:109606012-109606034 CTCAAACTCACAAGCCTCCAGGG + Intergenic
1102116155 12:110404462-110404484 CGCAAACTCAAATGTATACAGGG + Intergenic
1102396633 12:112591467-112591489 CTCCAACTCAAATGGCTACAGGG - Intronic
1103806611 12:123578701-123578723 CTCAAATTCAAATGCCTTCAGGG - Intergenic
1103927362 12:124430319-124430341 CTCAAACTCAGCTGCCTTCAGGG + Intronic
1104346926 12:128008625-128008647 CACAAACTCAAATGCCTCCAGGG + Intergenic
1104378490 12:128286323-128286345 TACAAACTCAAATGCCTCCAGGG + Intronic
1104381839 12:128314062-128314084 TCCAAATTCAAGTGTCTCCCAGG - Intronic
1104498408 12:129262420-129262442 CCCAAACTCAAGTTTTTACAGGG + Intronic
1104648460 12:130513885-130513907 CTGATCCCCAAGTGTCTCCAGGG + Intronic
1106422128 13:29593441-29593463 CCGAGACTCAAGTATCTCCAAGG + Intronic
1106518516 13:30475948-30475970 CCCCAACTCAAATGTCTGCAGGG - Intronic
1107164230 13:37266276-37266298 CTAAAACTGAAGTGTCAGCAAGG - Intergenic
1107253563 13:38395089-38395111 CTCAAACCCCAGTGACTCAAAGG - Intergenic
1107874876 13:44781675-44781697 CACAAACTCAGGTGTCTTCATGG - Intergenic
1107919811 13:45193890-45193912 CTCAAACTTAAGAGTTTCCAAGG + Exonic
1107924120 13:45241383-45241405 CACAAACTCAAATGTCTACAGGG - Intronic
1108410507 13:50141822-50141844 CTCACACTGCAGTGTCTCAAAGG + Intronic
1108961548 13:56238515-56238537 CTGAAAGTCAAGTTTCACCAGGG + Intergenic
1109855697 13:68124614-68124636 CTCAAACTCAAGTTCCCACAGGG + Intergenic
1111495996 13:89051628-89051650 TACAAACTCCAGTGTCTACAAGG - Intergenic
1112543817 13:100344353-100344375 CTCAAACTCAACTGCCTAAATGG - Intronic
1112821108 13:103336849-103336871 CTCAAACTGAAGAGTTTCCTGGG - Intergenic
1117337090 14:54765193-54765215 CTAAAACTCCAGTGGCTCCTTGG + Intronic
1118363755 14:65076940-65076962 CTCACGCTCCAGTCTCTCCACGG - Intronic
1118792903 14:69111902-69111924 TTCCAACTCCAGTGTCTACAGGG + Intronic
1119064027 14:71507888-71507910 CACAAACTTAAGTGCCTGCAGGG + Intronic
1120016953 14:79484631-79484653 CACAAAATCAAATGTCTCCAGGG - Intronic
1120680468 14:87475001-87475023 CTGAAACACAACTGCCTCCAAGG - Intergenic
1126384761 15:48082853-48082875 CTCAAACAAAGGTGTCTCCAAGG - Intergenic
1126633302 15:50758650-50758672 CACAAACTCAAATGCCTACAAGG + Intronic
1126685841 15:51248141-51248163 CCCAAGCTCTAGTGTCTTCAAGG + Intronic
1127313459 15:57772642-57772664 CTCAAACTTCAGTGTCTATACGG + Intronic
1130148112 15:81290852-81290874 TGCAAACTCAAGTGCCTGCAGGG - Intronic
1130290183 15:82592204-82592226 CTGAACCTGCAGTGTCTCCAGGG - Intronic
1130745945 15:86654120-86654142 CACAAACTCAGATGTCTCTATGG + Intronic
1133298897 16:4769589-4769611 CCCAAACTCTATTGACTCCAAGG - Intergenic
1133842391 16:9421507-9421529 CTCAAACTCCAGGGTCTACAGGG - Intergenic
1135043344 16:19134899-19134921 CACAAACTCAAATGCCTACAGGG - Intronic
1136104500 16:28019983-28020005 CTGAAACTCTAGTGCCTACAAGG - Intronic
1137540987 16:49361495-49361517 CACAAACACAAATGTCTTCAAGG + Intergenic
1138194381 16:55041561-55041583 CTCAAACTGAAATTCCTCCAAGG - Intergenic
1138581032 16:57940447-57940469 CTCAACCTCAGGAGCCTCCAGGG + Intronic
1139965606 16:70743767-70743789 GTGAATCTCAGGTGTCTCCATGG - Intronic
1140233315 16:73136162-73136184 GGCAAACTCAAGTGGCTCCATGG - Intronic
1140674492 16:77314212-77314234 TGCAAACTCAAGTATCTCCTGGG + Intronic
1142887941 17:2924814-2924836 CTCAAACCCAGATGTCTTCAGGG - Intronic
1143036202 17:4000598-4000620 CACAAACTCATGGGTCTCCCAGG + Intergenic
1145751799 17:27360651-27360673 CTGAAACCCAAGTGTCAGCAGGG - Intergenic
1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG + Intronic
1146637852 17:34519399-34519421 CTCAACCCCACCTGTCTCCATGG + Intergenic
1146686695 17:34845926-34845948 CCCAAACCCTAGTGCCTCCAGGG + Intergenic
1147362545 17:39940667-39940689 CTCAAACTCATGAGGCTCCTTGG + Intergenic
1147982338 17:44282328-44282350 ATCAAACTCAACTGTGTGCATGG - Intergenic
1148589136 17:48802480-48802502 CACAAACTCAAATGCCTTCAAGG + Intronic
1149322574 17:55496578-55496600 CTCAATCACTAGTGTCTTCAGGG + Intergenic
1149541485 17:57471159-57471181 CACAAACTCAAGTGCCTCAGAGG - Intronic
1149986120 17:61348385-61348407 CTCTAACTCAGGTCTCTCCTGGG - Intronic
1150089307 17:62307732-62307754 CTCAAACTTCAGTTACTCCAGGG + Intergenic
1151238014 17:72735694-72735716 AGCAAACTCAAGTGGCTTCAGGG - Intronic
1151258196 17:72896023-72896045 CTTAAACTCAATAGTCTTCAGGG + Intronic
1151994608 17:77600744-77600766 GTCAAACTCAGGTGTCCTCAAGG - Intergenic
1153736986 18:8081559-8081581 CTCAAACTCAAATGTCCATATGG - Intronic
1153906209 18:9663549-9663571 CTCAAACGCCCGTGTCTCAAGGG + Intergenic
1155496804 18:26450869-26450891 AGCAAACTCAGATGTCTCCAAGG - Intergenic
1156409585 18:36815080-36815102 CTCTAAATGAGGTGTCTCCAAGG + Intronic
1157027160 18:43858643-43858665 CTCCAATTCAAATGTCTGCAAGG + Intergenic
1157081091 18:44525977-44525999 CTCAAACTCAAAAGTCTAGAGGG + Intergenic
1157470038 18:47982101-47982123 CTCAAACTCAAAGGTCTTCAGGG - Intergenic
1157542637 18:48522651-48522673 CTAAAACTTAAGTGTTTCTAGGG - Intergenic
1160622453 18:80180585-80180607 CTCAAGCTTAACTGTCTCTATGG + Intronic
1160663786 19:313411-313433 CTCACACCCCAGTGCCTCCAGGG - Intronic
1162321179 19:9971204-9971226 CTGAAACTCCAGGGTCTCCTGGG + Exonic
1162823492 19:13237179-13237201 CTCAAACTCAAATGCCTCTGGGG - Intronic
1163187816 19:15652145-15652167 TTACAACTCAAATGTCTCCAGGG + Intronic
1163305958 19:16479050-16479072 TTCAAACTCAAATGTCTACATGG - Exonic
1163759174 19:19125238-19125260 GTCAAATTTGAGTGTCTCCACGG - Intronic
1164545853 19:29162073-29162095 CTCATACTGAGTTGTCTCCAAGG + Intergenic
1164966617 19:32490211-32490233 CCCAAATTCCAGTGTCTCCTCGG - Intergenic
1165285703 19:34839671-34839693 CCCAGGCTCAAGTCTCTCCAGGG - Intergenic
1166166084 19:40989886-40989908 CTGGAGCTCAAGAGTCTCCAGGG + Intergenic
1166391242 19:42409977-42409999 CTCAAACTCAAGTGACTTCAGGG + Intronic
928707270 2:33963895-33963917 CTCAAAATTAAGTATCTACAGGG + Intergenic
930093237 2:47546955-47546977 CCCACACCCAAGTCTCTCCAGGG - Intronic
931175202 2:59847440-59847462 ATCAAACTGAGGTGTCTACATGG + Intergenic
931978968 2:67674146-67674168 CAAAAACTCAAGTATCTACAGGG - Intergenic
932760252 2:74434955-74434977 CTCAGACTCAAGTGATGCCAGGG + Intronic
933293472 2:80463568-80463590 TTCAAAATCAACAGTCTCCACGG + Intronic
934107331 2:88707529-88707551 CTCAAACTAAACTGTATCTAGGG - Intronic
935211680 2:100944200-100944222 CTCAAGGTGAAGTTTCTCCAGGG + Intronic
935569570 2:104644755-104644777 CTCATAATGAAGTGTCACCATGG + Intergenic
935854271 2:107257827-107257849 CTTTAACTCAAGTGTAGCCACGG - Intergenic
936300425 2:111300707-111300729 CTCAAACTCAGTTTTCTCAAAGG + Intergenic
936487628 2:112939926-112939948 CTCAAGCTCAGCTCTCTCCATGG + Intergenic
938824594 2:134992483-134992505 CAAAAGCTCCAGTGTCTCCAGGG + Intronic
939313455 2:140515309-140515331 AACAAACCCAAGTGTTTCCAAGG - Intronic
940164696 2:150757469-150757491 CTCAAGCTCAAATGTTTTCAGGG - Intergenic
940558768 2:155266616-155266638 CCCAAACTGGAGTGTCTCCCAGG - Intergenic
942293367 2:174494343-174494365 TCAAAACTCAAGTGTCTACATGG + Intergenic
942323390 2:174755232-174755254 CACAAACTCAGATATCTCCAGGG + Intronic
943100084 2:183477542-183477564 TTGAAACTCAAGTGCCTACAGGG - Intergenic
943737051 2:191367480-191367502 CTCAAACTCAAATGTTTCCAGGG - Intronic
944273578 2:197809670-197809692 CACAAACTCCACTGTCTGCAGGG - Intronic
944508973 2:200445682-200445704 CTCAAACTAAAGGGGCTTCAAGG - Intronic
946388214 2:219399057-219399079 CTCAAACTTAAGTGCTTGCAAGG - Intronic
947756971 2:232573445-232573467 CTCAAACTCAAGTTTTCTCAGGG - Intronic
1169497841 20:6132206-6132228 CTGTAACTCAAGTAACTCCAGGG + Intergenic
1170851075 20:20005017-20005039 CTCCAACTGAAGCTTCTCCAGGG - Intergenic
1172331594 20:34079458-34079480 CTCAAACACTAGTGTTTCCAGGG + Intronic
1173134477 20:40427151-40427173 CTGAAACTCAAGTGTCAGCAAGG + Intergenic
1173952847 20:47006877-47006899 TGCAAACTCAAGTGTCTTCATGG - Intronic
1174442753 20:50569153-50569175 CTCAAATCCAAGTCTCACCACGG + Intronic
1174505165 20:51012901-51012923 CTCAAACTCAAATGCCTATAGGG - Intronic
1174760622 20:53203498-53203520 CTCAAACTCATAGGTCTACAGGG + Intronic
1174860000 20:54082254-54082276 CACAAACTCAAGTGTCTGCAGGG - Intergenic
1177394638 21:20516827-20516849 CCCAAACTCAAGTCTCTACTGGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178679031 21:34656473-34656495 GTCAAACACATATGTCTCCAAGG + Intergenic
1178804715 21:35829389-35829411 TTCAAGCTTAAGTGACTCCAGGG + Intronic
1178886641 21:36489973-36489995 CTCAAACACAATTTTCTGCAAGG + Intronic
1179392960 21:41010786-41010808 CTCAAACTCAAATGCCTGCAGGG + Intergenic
1180096329 21:45556928-45556950 CTCAGACGCATGTGTCTCCTGGG + Intergenic
1182588595 22:31361855-31361877 CTCAAACTCAGGTGTTTCTAAGG + Intergenic
1184380898 22:44144231-44144253 CCCAGACTCAGGTGTCTCCAGGG + Intronic
1184782995 22:46658420-46658442 CTCACACTCAGGCCTCTCCAGGG - Intronic
949280557 3:2341951-2341973 ATTAAACTCAAGTGTCTACTGGG - Intronic
950143583 3:10632363-10632385 GGCAAACTCAAATGTCTCCAGGG - Intronic
950636419 3:14318330-14318352 CGCAAACTCCAGCGTCTGCAAGG - Intergenic
951315095 3:21179986-21180008 CTAAAGCCCAAGTTTCTCCATGG - Intergenic
951621908 3:24611324-24611346 CTCATACTCCAGCATCTCCAAGG - Intergenic
955110821 3:55947924-55947946 TGCAAACTCAAATGTCTTCAGGG - Intronic
955983014 3:64546306-64546328 CTGAAACTCAAGATGCTCCAAGG + Intronic
956035540 3:65087155-65087177 CAAAAACTCAAGTCTTTCCAAGG - Intergenic
956422603 3:69100416-69100438 CATAAACTCAAATGCCTCCATGG + Intronic
959594292 3:108112185-108112207 ATCAAACTAGAGTGTGTCCAAGG - Intergenic
960604211 3:119488311-119488333 GTCAAACTCAGATGTCCCCAGGG + Intronic
960614191 3:119581923-119581945 CTCAAACTGCATTATCTCCATGG + Intronic
960807787 3:121600624-121600646 ATCAAACACCTGTGTCTCCATGG + Intronic
960883010 3:122365070-122365092 CTCAAAGACAACTGTCTCAAAGG - Intronic
961862569 3:129928354-129928376 TGCAAACTCAAATGTCTTCAGGG + Intergenic
962731565 3:138288598-138288620 CTCAAACTCAAATGTCTTGAGGG - Intronic
962974438 3:140433889-140433911 CTCAGCCTCAATTGTCTCCATGG + Intronic
963447842 3:145438058-145438080 CACTTACACAAGTGTCTCCAGGG + Intergenic
963609749 3:147452410-147452432 CTCAACCACCTGTGTCTCCAGGG - Intronic
964037880 3:152220759-152220781 TTCAAACTCAAATATCTACAGGG + Intergenic
964395777 3:156244167-156244189 CTAAAACCGAAGTGTCTCCTGGG + Intronic
965378700 3:167960308-167960330 CTCAACCTCAAGTATTTGCATGG + Intergenic
965808009 3:172562273-172562295 CTGAAACTCAAGAGTCATCAGGG + Intergenic
966003441 3:174978844-174978866 ATTAAACACAAGTGCCTCCAAGG - Intronic
966339079 3:178905144-178905166 CTAAAACCCAAGTGTATCCCAGG + Intergenic
967230908 3:187336607-187336629 ATCAAACTCAAGTGTCATCAAGG + Intergenic
967266296 3:187695203-187695225 TTCAAAATCAAGTTTCTCAAAGG - Intergenic
968460647 4:723269-723291 CTCAAGGTCACGTGGCTCCATGG - Intronic
968539533 4:1157097-1157119 CTGAACCTGCAGTGTCTCCAAGG - Intergenic
970796076 4:19915072-19915094 CTGAAACTCAGATGTCTGCAGGG + Intergenic
971090374 4:23336473-23336495 ATAAAATTCAAGTGTCTCAATGG + Intergenic
971163062 4:24154063-24154085 GTCAATTTCAAGTGTCTGCATGG - Intergenic
971222372 4:24720134-24720156 GTCACCCTCAAGAGTCTCCATGG - Intergenic
972359774 4:38316135-38316157 CTGAGATTCAAGTGTCTGCATGG - Intergenic
973703015 4:53554879-53554901 CTCAAAGTCAAATGCCTGCAGGG - Intronic
974669995 4:65017467-65017489 GCCAAAATCAAGTGTCTGCAAGG + Intergenic
975802310 4:78074047-78074069 CCCAAACTCAAGAGCCTCCTGGG - Intronic
976140825 4:81989704-81989726 ACCAAACTCTGGTGTCTCCAAGG - Intronic
978597906 4:110398880-110398902 TTCAAACTCAAATGCTTCCAGGG + Intronic
979668864 4:123341657-123341679 CTTGAACTGAACTGTCTCCATGG + Intergenic
979906256 4:126297584-126297606 TTCAAACTCAAGTTTCTTCTGGG + Intergenic
981514281 4:145589990-145590012 CTGAAACTAAAATGTCTCCCAGG - Intergenic
981815982 4:148830877-148830899 TTCAAACCAATGTGTCTCCAAGG - Intergenic
982108572 4:152032616-152032638 CTCAAACTCTGCTTTCTCCAGGG - Intergenic
982421649 4:155206149-155206171 CTCAAACTCAGATGCCTGCATGG - Intergenic
983444285 4:167829491-167829513 CTAAATCCCAAGTATCTCCAAGG - Intergenic
984607586 4:181803572-181803594 CTTAAACTCAGATGCCTCCATGG + Intergenic
984984422 4:185314103-185314125 CTCAAACTCATGTTGCTCAAGGG + Intronic
987984207 5:25124850-25124872 CTCACACTTAAATGTTTCCAGGG - Intergenic
989252189 5:39330305-39330327 CTGAAACACATGTGTTTCCAGGG + Intronic
989461113 5:41699207-41699229 CACAAAATCAAATGTCTACAGGG - Intergenic
989566940 5:42910274-42910296 CTCAAAGTCAAGTATCTACTTGG - Intergenic
990087891 5:52001422-52001444 CTAAAACTCAAGTGTGTCAGGGG + Intergenic
990820857 5:59838728-59838750 CTCAAAGGCAACTGTCTACAGGG + Intronic
991471018 5:66969275-66969297 ACCAAACTCAAGTATCTCCAGGG - Intronic
991723194 5:69513216-69513238 CTCAACTTCAAGTGCCTCCCAGG + Intronic
991982465 5:72247100-72247122 CACAAACTCAACTGTCTACAGGG + Intronic
992467968 5:77025770-77025792 AGCAAACTCAAATGGCTCCAAGG - Intergenic
992537474 5:77723350-77723372 CATAAACTCAAGTTTCTACAAGG - Intronic
993031146 5:82707269-82707291 CTCAACCTCAAATCTCTCCATGG - Intergenic
993585780 5:89725970-89725992 CTCAAACTCAAATGTCTTGAAGG + Intergenic
993593462 5:89824795-89824817 CTGAAACTCAACAGTCTTCAGGG + Intergenic
993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG + Intergenic
994312259 5:98287269-98287291 CTCCAACACTAGTGTCTCTAGGG + Intergenic
995010983 5:107256993-107257015 TGCAAACTCAAATGTCTACAAGG - Intergenic
995800040 5:115984105-115984127 CACAAACTCAAATGCCTACAAGG - Intronic
999023466 5:148197419-148197441 CTCAAACTCAAATGCCTCCAAGG + Intergenic
999609665 5:153355073-153355095 TGCAAACTCAAGTGCCTACAGGG + Intergenic
1001593545 5:172882859-172882881 CTCAAATTCAGGTGCCTACAAGG + Intronic
1001892933 5:175354236-175354258 CTCAAAAGCCAGTGTCTCCTTGG - Intergenic
1002054434 5:176590542-176590564 CTCACACTCATCTTTCTCCAGGG + Exonic
1004231044 6:13833715-13833737 CACTTACCCAAGTGTCTCCAAGG - Intergenic
1004461829 6:15843955-15843977 TTAAACCTCAAATGTCTCCAGGG - Intergenic
1006136572 6:31899748-31899770 CTCAAGAGCAAGTCTCTCCAAGG + Exonic
1006920414 6:37624220-37624242 CTCTCACTCACCTGTCTCCATGG - Intergenic
1007154561 6:39729849-39729871 TGCAAACTCAAATGTCTCCTGGG + Intergenic
1009001473 6:57721699-57721721 CCCAAACTCAAGTGCCGCCTTGG + Intergenic
1011100712 6:83718822-83718844 CTCACTCTTAAGTTTCTCCATGG - Intergenic
1012300401 6:97580562-97580584 CTCAAACTCAAATGCCTCTAGGG - Intergenic
1012790254 6:103684677-103684699 CTGAATGTCAAGTTTCTCCACGG - Intergenic
1016394316 6:143606022-143606044 CTGAAACACAACTGACTCCAAGG - Intronic
1017321012 6:153093337-153093359 CTGAAACTCATGGTTCTCCAAGG + Intronic
1018537296 6:164835078-164835100 CTAAAACTAAAGTCGCTCCACGG - Intergenic
1019053036 6:169199544-169199566 CTGGAACACAAGCGTCTCCAAGG - Intergenic
1020673580 7:11151656-11151678 CTCAAACTCAAGAGTCTTAAAGG - Intronic
1022588674 7:31640475-31640497 CTCAGCTTCAAGTGTCTGCAAGG + Intronic
1022629082 7:32068717-32068739 CTCTAGCCCAAATGTCTCCATGG + Intronic
1027828049 7:83141444-83141466 CTTAAACTCAATTATCTCTATGG + Intronic
1028141432 7:87279588-87279610 CTCAACCTCACTTGTCTCTAGGG - Intergenic
1030979699 7:116171823-116171845 CTCAGACTCAGGTGGATCCAAGG + Intergenic
1032483482 7:132265125-132265147 CTCAAACCCAGGTCTCTTCAGGG - Intronic
1032550726 7:132781612-132781634 CTCAAAATCAAGTGGGTCAAGGG + Intergenic
1033237759 7:139651574-139651596 CACGAACTCAAGTGCCTCCAGGG - Intronic
1034843779 7:154424363-154424385 CTCAAATCAAAGTGTCTGCAGGG + Intronic
1037667213 8:20980577-20980599 CTAAAATTCAAATGTCTCCAGGG - Intergenic
1037781976 8:21875731-21875753 TTCAAACTCAAATGCCTACAGGG + Intergenic
1039869861 8:41536783-41536805 CACAAACTCAAATGTTTGCAGGG - Intronic
1040631773 8:49222082-49222104 ATCAAAATCCAGTGTCTTCAGGG - Intergenic
1041775636 8:61519820-61519842 CTAAAATACAAGTGTCACCAGGG - Intronic
1042336761 8:67638156-67638178 CTCAAACTCTAGGGCATCCAAGG - Intronic
1044756307 8:95465537-95465559 CTCAAACTGAGGAGTGTCCAGGG - Intergenic
1047437628 8:124847879-124847901 GTCAAACTCAAGTGGCGTCAGGG - Intergenic
1047527946 8:125649732-125649754 CTCAAAGTCTAGGGTCCCCAGGG - Intergenic
1047569121 8:126078665-126078687 CACAAGCTCAATTGTCTACAAGG - Intergenic
1050638262 9:7637259-7637281 CCAAAACTCAAATGCCTCCAGGG - Intergenic
1050651453 9:7781434-7781456 CTCTAACTCAACTTTCTCCCAGG - Intergenic
1053027073 9:34738965-34738987 CTCAAACTCAGGAGGTTCCAGGG - Intergenic
1053372236 9:37572146-37572168 CTCAACCTCAAGAGTAACCAAGG + Intronic
1053854419 9:42323309-42323331 CTCAACCTCAAGTGCCACCCTGG + Intergenic
1054913793 9:70477908-70477930 CTTAAACCCAAGTCTATCCAAGG - Intergenic
1055102138 9:72477095-72477117 CTCAAACTCAAATATCTACAGGG - Intergenic
1055259607 9:74417655-74417677 TACAAACTCAAATGCCTCCAAGG - Intergenic
1055637729 9:78295167-78295189 CACAAACTCAAATGCCTCCAGGG - Intergenic
1055907901 9:81315057-81315079 CTCAATCTCCATTGACTCCATGG + Intergenic
1056951776 9:91045941-91045963 GTCAGTCTCAAGGGTCTCCAAGG + Intergenic
1058082978 9:100718742-100718764 CTCAAGCTCAAGAGGCTGCATGG - Intergenic
1058725879 9:107803633-107803655 CCCAAACTCAAATGACTTCAGGG + Intergenic
1059689760 9:116673753-116673775 CTCAAATTAAGGTGTCACCAGGG - Intronic
1059834414 9:118134747-118134769 CTCAAACTTAAATGTCTAAAGGG + Intergenic
1060069665 9:120534929-120534951 CTCACAGTCTAGTGGCTCCATGG + Intronic
1060509338 9:124220781-124220803 CTCAAACCCTGGTGACTCCAGGG - Intergenic
1060697070 9:125718488-125718510 CTCAAACTCAAGTACCTGTAAGG - Intergenic
1060861948 9:126961816-126961838 CACAAACTCTAGTGCCTGCAAGG + Intronic
1062626982 9:137447843-137447865 CTCAACCTCAGGTGTCCTCAGGG - Exonic
1185687375 X:1940393-1940415 CTCAAACTCAAGTCTCAGTAAGG + Intergenic
1186124170 X:6394929-6394951 CTGAAACTCTAGTGTGGCCAGGG + Intergenic
1189187259 X:39065138-39065160 CCCAAATGCAAATGTCTCCAAGG - Intergenic
1189883824 X:45519368-45519390 CTCAAACTCAGGTGTTCCAAAGG + Intergenic
1192336672 X:70227174-70227196 TGCAAACTCAAATGTCTCTAGGG - Intergenic
1193546791 X:82841448-82841470 CTCTAACCCAAATCTCTCCAAGG + Intergenic
1195579066 X:106481217-106481239 CTCAGACTCAAGTATTACCATGG + Intergenic
1196157411 X:112446354-112446376 CACATTCTCAAGGGTCTCCAAGG + Intergenic
1198541200 X:137641739-137641761 CTAAAACTGAAGTGTCTCATAGG - Intergenic
1200578808 Y:4923858-4923880 CTGAAACTAAAATGTCTACACGG - Intergenic