ID: 1101829941

View in Genome Browser
Species Human (GRCh38)
Location 12:108249241-108249263
Sequence ATAGCAAAGGACCCATTTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101829941_1101829946 30 Left 1101829941 12:108249241-108249263 CCTACAAATGGGTCCTTTGCTAT 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1101829946 12:108249294-108249316 AGATGGAACCACACCCAAAATGG 0: 1
1: 0
2: 3
3: 14
4: 136
1101829941_1101829945 13 Left 1101829941 12:108249241-108249263 CCTACAAATGGGTCCTTTGCTAT 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1101829945 12:108249277-108249299 CAAGAGTGTTCTTAATCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101829941 Original CRISPR ATAGCAAAGGACCCATTTGT AGG (reversed) Exonic
907634447 1:56119274-56119296 ATAGGCAAGGACCCAGTTGCAGG - Intergenic
909809520 1:79914688-79914710 ATACCAAAGGACCACTTTGGAGG - Intergenic
911899018 1:103477422-103477444 AAGGCAAAGGATCCATTTGTAGG + Intergenic
912691890 1:111810866-111810888 ACAGCAAAGACCCAATTTGTTGG - Intronic
914673548 1:149890174-149890196 ATAACCAAGGACCCTTTTCTAGG - Intronic
915282017 1:154829281-154829303 AGCGCAAAGGAACCACTTGTGGG - Intronic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
917128758 1:171717556-171717578 ATTGCAAAGGAGCTATTTCTAGG - Intronic
918393341 1:184089368-184089390 ATGGCTAAGGCCCTATTTGTTGG + Intergenic
918399579 1:184150559-184150581 ATAGCAAAGGGCACAATTATGGG - Intergenic
923659028 1:235942602-235942624 ATAGTGAAAGAACCATTTGTGGG - Intergenic
1063768311 10:9168626-9168648 TTAGCAAATGACCCATGTCTGGG - Intergenic
1071545141 10:86523004-86523026 AAAGCAAATTATCCATTTGTGGG - Intergenic
1071806820 10:89131421-89131443 ATAGCAAAGAACACAATTGCTGG - Intergenic
1077361155 11:2140623-2140645 ATTGCAAAGATCTCATTTGTGGG - Intronic
1080237618 11:30090059-30090081 ATAGCAAGGGACCCTGATGTGGG - Intergenic
1085655112 11:78307240-78307262 AATGCAAAGGACCCACTTCTAGG - Intronic
1085709541 11:78816507-78816529 GCAGCAAAGGATCTATTTGTAGG + Intronic
1088139092 11:106594112-106594134 ATATTATAGGACCCATTTGGGGG - Intergenic
1093417718 12:18939540-18939562 ATACCAAAGCACCATTTTGTTGG + Intergenic
1101228517 12:102714261-102714283 TTAGCATAGAACCCATCTGTTGG - Intergenic
1101829941 12:108249241-108249263 ATAGCAAAGGACCCATTTGTAGG - Exonic
1101949487 12:109163385-109163407 ATAACAAAGGGAACATTTGTAGG + Intronic
1104316171 12:127703953-127703975 ATAACAAAGGACCTATATTTTGG + Intergenic
1104944793 12:132410764-132410786 ATGGCAAAGGACCTTTTTGGGGG + Intergenic
1109602401 13:64649399-64649421 ATAGCAACAGTCCCATTTCTTGG - Intergenic
1110511789 13:76359364-76359386 ATAGGAAAGGAAACAATTGTTGG - Intergenic
1112763641 13:102718224-102718246 AGAGCAAGGGACCCTGTTGTTGG - Intergenic
1120667890 14:87328785-87328807 ATGGCAAACGAACCATTTTTAGG + Intergenic
1121939911 14:98060393-98060415 AGTGGAAAGGACACATTTGTTGG + Intergenic
1122899022 14:104774478-104774500 AAAGCAAAGGCCCCATCTGCAGG + Intronic
1127170047 15:56291868-56291890 ATAACAAAGGACCCACTTCGTGG + Intronic
1128246626 15:66137080-66137102 TTAGCAAAGGCCCCATTCATGGG - Intronic
1129136109 15:73553389-73553411 ATAACAACCAACCCATTTGTAGG - Intronic
1131319951 15:91378073-91378095 ATGGCAAAGATCCCAATTGTTGG + Intergenic
1134680075 16:16118678-16118700 TTAGCAAAGGACCAAGTTCTAGG + Intronic
1135660086 16:24288768-24288790 AAAGCAAGGCTCCCATTTGTTGG + Intronic
1139315128 16:66061241-66061263 ATAGCAAAGGAACCCTTTCATGG + Intergenic
1139771253 16:69279494-69279516 AGGGCAAAGGACCCACTTCTTGG - Intronic
1149262654 17:54896668-54896690 AAGAAAAAGGACCCATTTGTAGG - Intergenic
1156104456 18:33641446-33641468 ATAGGAAAGGGCCCAATTGTAGG + Intronic
1157168088 18:45376918-45376940 AGAGAAAAGGACCTATTTTTAGG - Intronic
1157539735 18:48492027-48492049 GTAGCAGATGACCCAATTGTGGG + Intergenic
1158815664 18:61092978-61093000 AAATCAAAGGCCACATTTGTTGG + Intergenic
1158939187 18:62391233-62391255 ACAGGAAAGAACCCATATGTTGG - Exonic
1159463013 18:68744065-68744087 ATAGAAAATGTCCCATATGTTGG - Intronic
1160043633 18:75367678-75367700 ATTGCAAAGGCCCCATTTCCAGG + Intergenic
1160094240 18:75856793-75856815 CTAGCAAAGTTCTCATTTGTGGG - Intergenic
1160702263 19:513308-513330 GTAGTAAAGGCCCCATTTGTTGG - Intronic
1161562392 19:4980922-4980944 ACAGCATAGAAACCATTTGTGGG + Intronic
1163299715 19:16436532-16436554 AAAGCAAGGGACACATTTGGGGG + Intronic
1166003275 19:39890975-39890997 ATAGCAAAGTACCCCTTGTTAGG - Intronic
928903967 2:36352151-36352173 AAATCAAAGTGCCCATTTGTTGG - Intergenic
932451128 2:71811561-71811583 AAAGCATAGGCCCCATTTGAGGG - Intergenic
932606870 2:73171309-73171331 GTAGCAAAGGACCTTTTTTTTGG - Intergenic
932760380 2:74435864-74435886 ATAGCCAAGGAAGCATCTGTAGG - Intronic
933143241 2:78819956-78819978 ATAGAAAAGGTGCTATTTGTTGG - Intergenic
933925558 2:87089101-87089123 GTAGCAAAGGACCTTTTTTTTGG + Intergenic
934956176 2:98622108-98622130 AAAGCTGAGGACCCATTTCTAGG - Exonic
941156645 2:161987126-161987148 AGATCCAAGGACCCATTTTTGGG + Intergenic
941984537 2:171497241-171497263 ATAGAACAGAACCCATATGTAGG - Intergenic
942589402 2:177525463-177525485 ATACCAAAGGGCAAATTTGTTGG - Intronic
944265787 2:197724798-197724820 ATACCACAGGTCCCATTTGATGG + Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947783006 2:232787041-232787063 ATTGAAATGGACCCATTTGCAGG + Intronic
948857985 2:240739317-240739339 TTAGCAAAGGAAACATTTGGCGG + Intronic
1168742590 20:205691-205713 ATATTAAAGGACCCATTAGTGGG + Intergenic
1169627962 20:7594081-7594103 AAATAAAAGGATCCATTTGTAGG + Intergenic
1172195428 20:33088622-33088644 GCAGCAAATGACCCATTTGAGGG + Intronic
1173044929 20:39500991-39501013 ATAGCAAGGGAGCCAGTTGATGG - Intergenic
1178022793 21:28429160-28429182 CTAGTAAAAGACCCATTTTTGGG + Intergenic
949178781 3:1101256-1101278 AATGCAAAGGACCCCTTTTTGGG + Intronic
949415970 3:3814397-3814419 ATGGCAAGGGACCCATTTATGGG - Intronic
950315795 3:12001163-12001185 ATAGTAAGTGACCCAGTTGTGGG - Intergenic
951193376 3:19796569-19796591 ACCACAAAGGACCCATTTATTGG + Intergenic
951960826 3:28318319-28318341 AAAGAAAAGGAACAATTTGTTGG - Intronic
953542313 3:43832738-43832760 ATAGCACAGGACCCATTTAAAGG - Intergenic
955860956 3:63329853-63329875 CAAGCAAAGGACCCCTTTGTGGG - Intronic
957445687 3:80310834-80310856 AGAACAAATTACCCATTTGTTGG + Intergenic
958411393 3:93821081-93821103 AAAGCAAGTGACCCATTTGAAGG - Intergenic
965225600 3:165984917-165984939 ACAGAAAAGGACCAATTTATGGG + Intergenic
975353957 4:73377834-73377856 ATATGAAAGGACACATTTGATGG - Intergenic
979743617 4:124181457-124181479 ATAACAAAAAGCCCATTTGTAGG + Intergenic
979837421 4:125388507-125388529 ATACTACAGGACGCATTTGTAGG + Intronic
981883731 4:149647814-149647836 ATGGCAAAGGCCACATCTGTAGG - Intergenic
984608944 4:181816636-181816658 TCAGCAAAGGACCCAGTTGATGG - Intergenic
989309889 5:40002838-40002860 AATGCAAAGGAACCATTAGTGGG - Intergenic
992998095 5:82352213-82352235 ATAGCAAGGGACATATTTGAGGG - Intronic
993521789 5:88911728-88911750 ATAAAAAAGGACTCATCTGTTGG - Intergenic
995980936 5:118103514-118103536 ATAGCATAAGATCCATTTATTGG + Intergenic
1001893103 5:175355861-175355883 ATAGCAGAGTAGCCATTTCTAGG - Intergenic
1003003283 6:2357395-2357417 ACAGCAATGAATCCATTTGTTGG - Intergenic
1007997004 6:46318240-46318262 ATAGCAAAGTATCCTATTGTTGG + Intronic
1010180875 6:73085432-73085454 AAAGCAAAGGGGCCTTTTGTTGG - Intronic
1015524652 6:134164631-134164653 ATAGCAAAGGAAGCATTTGAAGG - Intergenic
1018641734 6:165909880-165909902 AGAGCAAAGGAGCCCTTTGGAGG - Intronic
1020293459 7:6740397-6740419 CCAGCAAAGGACCCAGTGGTGGG + Intergenic
1021080299 7:16356768-16356790 ATAGAAAAGGACCCAGATGTTGG - Intronic
1022377896 7:29831744-29831766 GTAGCAAAGGTCCTATGTGTTGG - Intronic
1024375241 7:48629901-48629923 ATGGCAAAGGACACAGATGTAGG + Intronic
1026094106 7:67327959-67327981 ATAAAAAAGGACTCATCTGTTGG + Intergenic
1027905958 7:84182152-84182174 ATCGCAAATAACCCATTTGCAGG - Intronic
1030170140 7:106593037-106593059 AGAGTAAAGGACCTATTTGAGGG - Intergenic
1034684734 7:152959933-152959955 CTAGCAAAAGGCCCATTTCTGGG + Intergenic
1042899866 8:73714310-73714332 AGAGCAAAGGACCCTTTCATGGG + Intronic
1048346730 8:133581440-133581462 ATAGCAAAGGCCTCATGTGGGGG - Intergenic
1051951107 9:22634374-22634396 ATAGCAAAAGACCAAATTCTTGG - Intergenic
1055029954 9:71763756-71763778 AGATCAAAGGACTGATTTGTTGG + Intronic
1055267824 9:74518437-74518459 ATAGCAAAGTACCACTATGTTGG - Intronic
1055840323 9:80495462-80495484 ATAGCAATAGTTCCATTTGTTGG + Intergenic
1061912578 9:133732823-133732845 ATAGCAAAGGCCCCCATTTTTGG + Intronic
1186843180 X:13505569-13505591 ATGGCACAGGAGCCATTTGTAGG + Intergenic
1191865233 X:65698497-65698519 TCAGCTAAGGAGCCATTTGTGGG - Intronic
1192808608 X:74530944-74530966 GTACCACAGGAACCATTTGTGGG + Intronic
1194980132 X:100432050-100432072 AGAGTAAAGGACAGATTTGTAGG - Intergenic
1198512030 X:137361737-137361759 TTAGCAAAGGACCTATTTGATGG + Intergenic