ID: 1101831816

View in Genome Browser
Species Human (GRCh38)
Location 12:108263779-108263801
Sequence TCCCCACTGTAACCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101831810_1101831816 2 Left 1101831810 12:108263754-108263776 CCCTGCCTTCTCCAGGTCTCAGT No data
Right 1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG No data
1101831813_1101831816 -9 Left 1101831813 12:108263765-108263787 CCAGGTCTCAGTCCTCCCCACTG No data
Right 1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG No data
1101831811_1101831816 1 Left 1101831811 12:108263755-108263777 CCTGCCTTCTCCAGGTCTCAGTC No data
Right 1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG No data
1101831808_1101831816 11 Left 1101831808 12:108263745-108263767 CCAACAAAGCCCTGCCTTCTCCA No data
Right 1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG No data
1101831812_1101831816 -3 Left 1101831812 12:108263759-108263781 CCTTCTCCAGGTCTCAGTCCTCC No data
Right 1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101831816 Original CRISPR TCCCCACTGTAACCCCAAGG TGG Intergenic
No off target data available for this crispr