ID: 1101834315

View in Genome Browser
Species Human (GRCh38)
Location 12:108284638-108284660
Sequence TACCCAGGACAGGTAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101834315_1101834320 -10 Left 1101834315 12:108284638-108284660 CCTGCCACTACCTGTCCTGGGTA 0: 1
1: 0
2: 0
3: 21
4: 135
Right 1101834320 12:108284651-108284673 GTCCTGGGTACCAGTGGAGGTGG 0: 1
1: 1
2: 2
3: 31
4: 272
1101834315_1101834321 -9 Left 1101834315 12:108284638-108284660 CCTGCCACTACCTGTCCTGGGTA 0: 1
1: 0
2: 0
3: 21
4: 135
Right 1101834321 12:108284652-108284674 TCCTGGGTACCAGTGGAGGTGGG 0: 1
1: 1
2: 2
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101834315 Original CRISPR TACCCAGGACAGGTAGTGGC AGG (reversed) Intergenic
901530865 1:9851769-9851791 TGGCCAGGACAGGCAGTGGCAGG + Intronic
902490191 1:16775818-16775840 TGCACACGACAGGTAGGGGCTGG - Intronic
902843683 1:19092791-19092813 TAGCCAGGACAGGTAGTGTGAGG - Intronic
903356348 1:22750249-22750271 AATCCAGGGAAGGTAGTGGCTGG + Intronic
904015641 1:27418258-27418280 TACCCCTTACAGGTAATGGCTGG - Exonic
905168092 1:36094996-36095018 AACCAAAGGCAGGTAGTGGCTGG - Intergenic
908794394 1:67816716-67816738 CTCCCAGGACAGGTAGGGCCCGG + Intronic
916837162 1:168557695-168557717 TACCAAGGACAAGCAGTGGCTGG + Intergenic
916980705 1:170133815-170133837 TACCCAGTCCAGCTACTGGCAGG + Intergenic
919330974 1:196171196-196171218 TACCCAGAATTGGTAGTGGAAGG + Intergenic
919881993 1:201906940-201906962 TACCCAGGACAGCTGGTGCCAGG - Intronic
923530247 1:234806712-234806734 TGCACATGACAGGTAGGGGCTGG + Intergenic
1063462503 10:6223514-6223536 TGCCCGGGACAGCTTGTGGCTGG + Intronic
1066065637 10:31759524-31759546 ACCGCAGGACAGGTAGGGGCGGG + Intergenic
1066644167 10:37588480-37588502 TACCCAGAAGAGGTAGACGCAGG + Intergenic
1067683733 10:48455433-48455455 TACGCAGGACAGGTTCTGGACGG - Intronic
1070343941 10:75523561-75523583 TACCCACCACAGGTAGAGACTGG - Intronic
1072722595 10:97789983-97790005 CACCCAGGACAGCAAGTGGGTGG + Intergenic
1073500938 10:103936370-103936392 TCCCCAGGACAGGAGCTGGCTGG + Intergenic
1076414601 10:130276859-130276881 AACCCAGGCCAGGTAGTCTCTGG - Intergenic
1077022336 11:423275-423297 TACCCAGCACAGCAAGGGGCTGG + Intronic
1077331501 11:1985812-1985834 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1078577457 11:12514077-12514099 ACCCCAGCACAGGTAGAGGCAGG + Intronic
1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG + Exonic
1082737970 11:56877326-56877348 TCCCCAGGACAGCTTGTGGAAGG + Intergenic
1084055737 11:66631431-66631453 TAGCCAGGCGAGGTGGTGGCAGG - Intronic
1084209839 11:67615831-67615853 TGCCCAGGGCAGCTAGAGGCAGG + Intergenic
1088049414 11:105493139-105493161 TACCCAAGACAGGTGGTTGGGGG - Intergenic
1088809837 11:113384784-113384806 AACCCTGGACAGGTTCTGGCAGG - Intergenic
1089917786 11:122175738-122175760 TACTCAGGAAAGGTAGAGGCAGG + Intergenic
1090262307 11:125330427-125330449 TGCCCAGGGCAGGCAATGGCTGG + Intronic
1202814482 11_KI270721v1_random:40988-41010 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1091435042 12:465753-465775 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435059 12:465814-465836 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435077 12:465875-465897 CCCCCAGGACAGGGAGTGGCAGG - Intronic
1091435112 12:465999-466021 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435129 12:466060-466082 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091435146 12:466121-466143 CTCCCAGGACAGGGAGTGGCAGG - Intronic
1091553514 12:1554546-1554568 TACCCAGGCCAGGTGCTGCCTGG + Intronic
1092986637 12:13852088-13852110 CACCCAAGACACGTGGTGGCAGG + Intronic
1101834315 12:108284638-108284660 TACCCAGGACAGGTAGTGGCAGG - Intergenic
1102015184 12:109643594-109643616 TCCCCAGGACAGGGTGTGGAGGG - Intergenic
1102512897 12:113427887-113427909 TAACCAGGACAGGGAGGGGAAGG - Intronic
1102580430 12:113882937-113882959 TTCCCAGGAGAGGCAGTTGCTGG + Intronic
1102973081 12:117186697-117186719 TACCCATGACTGGTAGTGCAAGG - Intronic
1102996625 12:117356423-117356445 GACCCAGGACAGGTGGTTGAAGG - Intronic
1103779154 12:123388213-123388235 TAACCAGGAAGGGTAGTGGCTGG + Intronic
1112977569 13:105339945-105339967 TAATCAGGAAAGGGAGTGGCTGG - Intergenic
1113831387 13:113297954-113297976 CACCCAGGACAGGGAGAAGCCGG + Intronic
1115793731 14:36909019-36909041 TAACCAGGATAGGAGGTGGCAGG + Intronic
1119569106 14:75654387-75654409 TACCCAAGACAGGTAGATTCAGG + Intronic
1122679318 14:103445484-103445506 ATCCCAAGAGAGGTAGTGGCAGG - Intronic
1124209912 15:27754060-27754082 TTCCCTGGACAGGCTGTGGCAGG + Intergenic
1126670320 15:51110307-51110329 ATGCCAGGACAGGGAGTGGCTGG + Intergenic
1128509215 15:68303195-68303217 TCCCAAGGAAAGGTAGTGGAGGG - Intronic
1129760510 15:78126572-78126594 GACGCAGGACATGGAGTGGCTGG - Intronic
1130313008 15:82771344-82771366 TGCCCAGGACAGGTGCTGTCAGG + Intronic
1131335450 15:91544671-91544693 TAACCAGGACACTTAGTGTCTGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138346755 16:56324834-56324856 TTCCCAGGACAGGCAATGGGAGG + Intronic
1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG + Intronic
1140194679 16:72846565-72846587 TACCCAGCAGAGGGAGTGGTGGG - Intronic
1143365603 17:6406559-6406581 GACACAGGACAGGTAGGGCCCGG - Intronic
1144371113 17:14592669-14592691 GACCCAGGAGAGGTAGGTGCTGG + Intergenic
1145960336 17:28883450-28883472 TGCCCAGGAGAGGCCGTGGCAGG - Intronic
1147182240 17:38693689-38693711 TGCCCAGGACAGGTGGTTCCTGG + Intergenic
1150224756 17:63518206-63518228 TCCCCAGGAGAGGCAGTGGTGGG - Intronic
1150229906 17:63544149-63544171 TCCCCAGGGCAGGTAGGGGGTGG + Intronic
1151389391 17:73775712-73775734 TACCCAGGATGGGTAGGGGATGG - Intergenic
1151480141 17:74365692-74365714 TACCCACTACCTGTAGTGGCTGG + Intergenic
1152082619 17:78197771-78197793 GACCCAGGACAAGCAGTGGAGGG + Intronic
1160457109 18:79009108-79009130 GACACAGGCCAGGGAGTGGCGGG - Intergenic
1160719848 19:592301-592323 TGCCCAGGGGAGGGAGTGGCTGG - Intronic
1160871192 19:1278690-1278712 CACCCAGGTCAGGCAGGGGCAGG - Intronic
1161064951 19:2233004-2233026 CAGCCAGGACAGGTGGAGGCTGG - Intronic
1161486742 19:4539953-4539975 TGCCTAGGACAGGTAGTGTGGGG + Intronic
1163648709 19:18504831-18504853 TCCACTGGACAGGTGGTGGCAGG - Intronic
1165905785 19:39193888-39193910 AATCCAGGGCAGGGAGTGGCTGG - Intergenic
1166277818 19:41767230-41767252 TCCACAGGGCAGGTAGTGGAGGG - Intronic
926830222 2:16953974-16953996 TTCCCAGGAAGAGTAGTGGCAGG - Intergenic
927227286 2:20780911-20780933 TTGCCAGGACTGGGAGTGGCAGG - Intronic
927314256 2:21663898-21663920 TACCCAGGAAAGGTGGTGTTTGG - Intergenic
927480910 2:23453305-23453327 CACACAGGACAGGTAGTTCCCGG - Intronic
933449230 2:82425152-82425174 TACCCTAGCCAGGTAGTGACAGG + Intergenic
934657540 2:96123912-96123934 TTCCCTGGACAGGGACTGGCTGG + Exonic
936097011 2:109538136-109538158 TCCACAAGCCAGGTAGTGGCTGG - Intergenic
937225900 2:120368545-120368567 AACCCATGCCAGGCAGTGGCTGG + Intergenic
944753173 2:202732286-202732308 TACCTAGGAGAGGAAGTGCCGGG - Intronic
948732930 2:239978561-239978583 TACACAGGACACCAAGTGGCAGG + Intronic
1173652990 20:44679221-44679243 TGCCCAGGCCAGATAATGGCAGG + Intergenic
1174420029 20:50393500-50393522 TACCCAGGACAGGCAGTGTATGG - Intergenic
1175479306 20:59300418-59300440 CACCCAGGACAGCGAGGGGCGGG - Exonic
1176058535 20:63161517-63161539 CACCCAGGGCAGGGAATGGCAGG - Intergenic
1180645483 22:17335102-17335124 AACCCAGGTCAGGGAGTGGTGGG + Intergenic
1180962749 22:19769622-19769644 TCCACAGGAACGGTAGTGGCTGG - Intronic
1182572189 22:31247895-31247917 TCCCCAGGACAGGCAGAGGGAGG + Intronic
952389838 3:32870594-32870616 TGGTCAGAACAGGTAGTGGCCGG - Intronic
958468096 3:94483277-94483299 GACCCAGGGCAGGGAGTGCCAGG + Intergenic
962144438 3:132825273-132825295 TAGCCAGGACAGGTCATGGGAGG + Intergenic
962965595 3:140350899-140350921 TGTACAGGACAGGTAGGGGCAGG - Intronic
964488138 3:157206895-157206917 TACCCAGGACAGGGAGAGGAAGG + Intergenic
967189834 3:186975711-186975733 TACCCATGAAAGGCAGTGCCAGG + Intronic
967399581 3:189045900-189045922 CACCAAGGTCAGGTAGGGGCTGG + Intronic
967745937 3:193055165-193055187 TGGTCAGGACAGGCAGTGGCAGG - Intergenic
968295321 3:197571913-197571935 TAGCCAGGCAAGGTTGTGGCAGG + Intronic
969724963 4:8913251-8913273 CACCCAGGACAGGCTGTGCCTGG - Intergenic
982754756 4:159204899-159204921 TGCCCAGTACTGGTAGTGTCAGG + Intronic
985543903 5:499825-499847 GACCCTGGACTGGGAGTGGCTGG - Intronic
985801291 5:2006772-2006794 TACGCAGGACCGGTGGTGACCGG - Intergenic
988478851 5:31612524-31612546 TACCCAGGAATGGTAGTGCACGG - Intergenic
990944985 5:61239735-61239757 TACCCAGGAAAAGTAGGGTCTGG + Intergenic
997128913 5:131257100-131257122 TACCCAGCCCAGCTAGTGGTGGG + Intronic
997301534 5:132809776-132809798 GACCCTGGGGAGGTAGTGGCAGG - Intergenic
997386862 5:133480533-133480555 TAACCAGGACAAGGAGTGGCTGG - Intronic
997628416 5:135347496-135347518 TTTCCAGGACAGGTAGAGGCAGG - Intronic
1000635819 5:163642624-163642646 TGCCCAGGACAGATATTGTCAGG - Intergenic
1000930859 5:167249542-167249564 TACCCAGTACAGTCAGTGCCTGG - Intergenic
1001311004 5:170610846-170610868 CATCCAGGACAGATGGTGGCAGG - Intronic
1005393033 6:25352961-25352983 CACCTACAACAGGTAGTGGCAGG - Intronic
1006017579 6:31094551-31094573 TACCCTGCTCAGGTACTGGCTGG - Intergenic
1007399365 6:41595052-41595074 TACCCTGGAGAGGTAGGGGGTGG - Intronic
1012947720 6:105485715-105485737 TACCCAGGAGTGGTAGTCTCCGG - Intergenic
1019921258 7:4164602-4164624 TACCTAGGTAAGGTATTGGCAGG - Intronic
1020099217 7:5385153-5385175 TACCCAGGACCGGCTGGGGCAGG + Intronic
1020142367 7:5619651-5619673 TTCCAAGGACAGGAAGTGCCTGG - Intergenic
1022485251 7:30772744-30772766 CAGCCAGGACAGGTGATGGCAGG - Intronic
1022518167 7:30988708-30988730 TCCCCAGGGAAGGGAGTGGCAGG - Intronic
1023966347 7:44964942-44964964 TACAGAGGACAGGTAGTCTCGGG + Exonic
1025809473 7:64866288-64866310 TACCCAAGGCAGGTGGTGGTAGG - Intergenic
1027232447 7:76280653-76280675 CACCCAGGAGAGGCAGAGGCAGG + Intronic
1027720137 7:81730304-81730326 TAGCCAGGAGTGGTGGTGGCAGG + Intronic
1029190044 7:98765364-98765386 TGCCCAGAACAGGAAGCGGCTGG - Intergenic
1032474450 7:132202693-132202715 TGCCCAGGAGAGCCAGTGGCTGG - Exonic
1034982463 7:155487795-155487817 TGCCCAGGACAGGCCGTGGAGGG + Intronic
1036168901 8:6464246-6464268 TACCCAGAGCTGGCAGTGGCGGG + Intronic
1037900328 8:22684432-22684454 TAGCCAGGAGAGGTGGTGGCAGG + Intergenic
1038709932 8:29933957-29933979 AACCCAGGACAGGTGGTGTTTGG - Intergenic
1039809791 8:41036457-41036479 TACCAAGCACAGATAGTGCCTGG + Intergenic
1044646269 8:94446743-94446765 TACCCAAGATTGGAAGTGGCAGG + Intronic
1048075089 8:131061457-131061479 TCCCCAGAAGAGGCAGTGGCAGG - Intergenic
1050108598 9:2191504-2191526 TACCCAGGACTGGAAATGTCAGG + Intronic
1051904033 9:22074713-22074735 TGCCCAGGAGAGGTAGTGGGTGG - Intergenic
1052535235 9:29737841-29737863 TACTCAGGAGAGGTTGAGGCAGG + Intergenic
1055119929 9:72648193-72648215 TACCAAGCACACTTAGTGGCTGG + Intronic
1056223765 9:84475230-84475252 TTACCAGGAAAGGTAATGGCTGG - Intergenic
1056680631 9:88714613-88714635 ACCCCAAGACAGGTACTGGCTGG + Intergenic
1056851267 9:90086467-90086489 TACCCAGGACAGGGAGTGAAAGG - Intergenic
1060486864 9:124053260-124053282 TACCCAGGACTGTCTGTGGCTGG - Intergenic
1060554015 9:124499130-124499152 AACCCAGGCCAGGGAGGGGCAGG + Intronic
1061939256 9:133875282-133875304 AAGCCAGGCCAGGCAGTGGCTGG - Intronic
1062130099 9:134887922-134887944 TACCCAGGACAGCAGGCGGCAGG - Intergenic
1188654602 X:32676247-32676269 TTCCCAGAACAGGTAGTGAAAGG - Intronic
1195497133 X:105549698-105549720 TACCTATGAAAGGTAGTGGGAGG - Intronic
1197011096 X:121564625-121564647 TACAGAGGAAAGGTAGTGGTTGG - Intergenic
1199522010 X:148746677-148746699 TGCCCAGGATAGGAAGTTGCAGG - Intronic
1200003997 X:153075554-153075576 AACCCAGGACAAGGAGTGGGGGG + Intergenic
1200141235 X:153904113-153904135 TTCCTAGGACAGGTAGTTGCAGG + Intronic