ID: 1101843621

View in Genome Browser
Species Human (GRCh38)
Location 12:108344701-108344723
Sequence CAGGGCAGGGAGAAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101843614_1101843621 1 Left 1101843614 12:108344677-108344699 CCTATTAAGAGTAAGGCAGGAGA No data
Right 1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG No data
1101843609_1101843621 21 Left 1101843609 12:108344657-108344679 CCCAGTGTCCTATTAAGAGTCCT No data
Right 1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG No data
1101843611_1101843621 13 Left 1101843611 12:108344665-108344687 CCTATTAAGAGTCCTATTAAGAG No data
Right 1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG No data
1101843610_1101843621 20 Left 1101843610 12:108344658-108344680 CCAGTGTCCTATTAAGAGTCCTA No data
Right 1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101843621 Original CRISPR CAGGGCAGGGAGAAGGCAGT GGG Intergenic
No off target data available for this crispr