ID: 1101843816

View in Genome Browser
Species Human (GRCh38)
Location 12:108346123-108346145
Sequence GGGCCTGGATGCTCATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101843816_1101843824 4 Left 1101843816 12:108346123-108346145 CCATTAGATGAGCATCCAGGCCC No data
Right 1101843824 12:108346150-108346172 ACTTTTGTCCAAGCTGGAAAGGG No data
1101843816_1101843828 28 Left 1101843816 12:108346123-108346145 CCATTAGATGAGCATCCAGGCCC No data
Right 1101843828 12:108346174-108346196 TAACAGCACTGAAGGGTTAATGG No data
1101843816_1101843820 -2 Left 1101843816 12:108346123-108346145 CCATTAGATGAGCATCCAGGCCC No data
Right 1101843820 12:108346144-108346166 CCCCAGACTTTTGTCCAAGCTGG No data
1101843816_1101843826 20 Left 1101843816 12:108346123-108346145 CCATTAGATGAGCATCCAGGCCC No data
Right 1101843826 12:108346166-108346188 GAAAGGGTTAACAGCACTGAAGG No data
1101843816_1101843827 21 Left 1101843816 12:108346123-108346145 CCATTAGATGAGCATCCAGGCCC No data
Right 1101843827 12:108346167-108346189 AAAGGGTTAACAGCACTGAAGGG No data
1101843816_1101843823 3 Left 1101843816 12:108346123-108346145 CCATTAGATGAGCATCCAGGCCC No data
Right 1101843823 12:108346149-108346171 GACTTTTGTCCAAGCTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101843816 Original CRISPR GGGCCTGGATGCTCATCTAA TGG (reversed) Intergenic
No off target data available for this crispr