ID: 1101844091

View in Genome Browser
Species Human (GRCh38)
Location 12:108348724-108348746
Sequence ATAGAGAGGGAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101844091_1101844098 28 Left 1101844091 12:108348724-108348746 CCTTCCTCTTTCTCCCTCTCTAT No data
Right 1101844098 12:108348775-108348797 AACACTCCCATTTTGCATATGGG No data
1101844091_1101844097 27 Left 1101844091 12:108348724-108348746 CCTTCCTCTTTCTCCCTCTCTAT No data
Right 1101844097 12:108348774-108348796 AAACACTCCCATTTTGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101844091 Original CRISPR ATAGAGAGGGAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr