ID: 1101844097

View in Genome Browser
Species Human (GRCh38)
Location 12:108348774-108348796
Sequence AAACACTCCCATTTTGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101844091_1101844097 27 Left 1101844091 12:108348724-108348746 CCTTCCTCTTTCTCCCTCTCTAT No data
Right 1101844097 12:108348774-108348796 AAACACTCCCATTTTGCATATGG No data
1101844093_1101844097 14 Left 1101844093 12:108348737-108348759 CCCTCTCTATCTCCAACTTTCTA No data
Right 1101844097 12:108348774-108348796 AAACACTCCCATTTTGCATATGG No data
1101844092_1101844097 23 Left 1101844092 12:108348728-108348750 CCTCTTTCTCCCTCTCTATCTCC No data
Right 1101844097 12:108348774-108348796 AAACACTCCCATTTTGCATATGG No data
1101844094_1101844097 13 Left 1101844094 12:108348738-108348760 CCTCTCTATCTCCAACTTTCTAC No data
Right 1101844097 12:108348774-108348796 AAACACTCCCATTTTGCATATGG No data
1101844095_1101844097 2 Left 1101844095 12:108348749-108348771 CCAACTTTCTACATATTTTATCC No data
Right 1101844097 12:108348774-108348796 AAACACTCCCATTTTGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101844097 Original CRISPR AAACACTCCCATTTTGCATA TGG Intergenic
No off target data available for this crispr