ID: 1101849979

View in Genome Browser
Species Human (GRCh38)
Location 12:108394099-108394121
Sequence GAAAGCACCTACTGAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101849977_1101849979 -5 Left 1101849977 12:108394081-108394103 CCTTCCATCTATTCTATAGAAAG No data
Right 1101849979 12:108394099-108394121 GAAAGCACCTACTGAGTGCCAGG No data
1101849975_1101849979 9 Left 1101849975 12:108394067-108394089 CCCTTTCTGTTCTTCCTTCCATC No data
Right 1101849979 12:108394099-108394121 GAAAGCACCTACTGAGTGCCAGG No data
1101849976_1101849979 8 Left 1101849976 12:108394068-108394090 CCTTTCTGTTCTTCCTTCCATCT No data
Right 1101849979 12:108394099-108394121 GAAAGCACCTACTGAGTGCCAGG No data
1101849978_1101849979 -9 Left 1101849978 12:108394085-108394107 CCATCTATTCTATAGAAAGCACC No data
Right 1101849979 12:108394099-108394121 GAAAGCACCTACTGAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101849979 Original CRISPR GAAAGCACCTACTGAGTGCC AGG Intergenic