ID: 1101849982

View in Genome Browser
Species Human (GRCh38)
Location 12:108394127-108394149
Sequence CACCTGTACCAACCCCACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101849977_1101849982 23 Left 1101849977 12:108394081-108394103 CCTTCCATCTATTCTATAGAAAG No data
Right 1101849982 12:108394127-108394149 CACCTGTACCAACCCCACCGTGG No data
1101849980_1101849982 -2 Left 1101849980 12:108394106-108394128 CCTACTGAGTGCCAGGCACTGCA No data
Right 1101849982 12:108394127-108394149 CACCTGTACCAACCCCACCGTGG No data
1101849978_1101849982 19 Left 1101849978 12:108394085-108394107 CCATCTATTCTATAGAAAGCACC No data
Right 1101849982 12:108394127-108394149 CACCTGTACCAACCCCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101849982 Original CRISPR CACCTGTACCAACCCCACCG TGG Intergenic