ID: 1101852439

View in Genome Browser
Species Human (GRCh38)
Location 12:108414725-108414747
Sequence TGGTTCTCAGGTGCTTCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101852439_1101852443 2 Left 1101852439 12:108414725-108414747 CCCGGTGAAGCACCTGAGAACCA No data
Right 1101852443 12:108414750-108414772 AATATCTCTCTCTGTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101852439 Original CRISPR TGGTTCTCAGGTGCTTCACC GGG (reversed) Intergenic
No off target data available for this crispr