ID: 1101852443

View in Genome Browser
Species Human (GRCh38)
Location 12:108414750-108414772
Sequence AATATCTCTCTCTGTTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101852440_1101852443 1 Left 1101852440 12:108414726-108414748 CCGGTGAAGCACCTGAGAACCAA No data
Right 1101852443 12:108414750-108414772 AATATCTCTCTCTGTTCTCATGG No data
1101852441_1101852443 -10 Left 1101852441 12:108414737-108414759 CCTGAGAACCAATAATATCTCTC No data
Right 1101852443 12:108414750-108414772 AATATCTCTCTCTGTTCTCATGG No data
1101852438_1101852443 3 Left 1101852438 12:108414724-108414746 CCCCGGTGAAGCACCTGAGAACC No data
Right 1101852443 12:108414750-108414772 AATATCTCTCTCTGTTCTCATGG No data
1101852439_1101852443 2 Left 1101852439 12:108414725-108414747 CCCGGTGAAGCACCTGAGAACCA No data
Right 1101852443 12:108414750-108414772 AATATCTCTCTCTGTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101852443 Original CRISPR AATATCTCTCTCTGTTCTCA TGG Intergenic
No off target data available for this crispr