ID: 1101853703

View in Genome Browser
Species Human (GRCh38)
Location 12:108424790-108424812
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101853703_1101853707 0 Left 1101853703 12:108424790-108424812 CCTTCCAGCTACAGAAGATGAGG No data
Right 1101853707 12:108424813-108424835 GTCTCTTTAAAATGTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101853703 Original CRISPR CCTCATCTTCTGTAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr