ID: 1101853816

View in Genome Browser
Species Human (GRCh38)
Location 12:108425661-108425683
Sequence ACACATTAGGTCCCACCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101853808_1101853816 21 Left 1101853808 12:108425617-108425639 CCTCAGCCTGATCCCACATGGAG No data
Right 1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG No data
1101853813_1101853816 -2 Left 1101853813 12:108425640-108425662 CCCTGAAACATAAGTGGCACTAC No data
Right 1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG No data
1101853814_1101853816 -3 Left 1101853814 12:108425641-108425663 CCTGAAACATAAGTGGCACTACA No data
Right 1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG No data
1101853809_1101853816 15 Left 1101853809 12:108425623-108425645 CCTGATCCCACATGGAGCCCTGA No data
Right 1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG No data
1101853811_1101853816 8 Left 1101853811 12:108425630-108425652 CCACATGGAGCCCTGAAACATAA No data
Right 1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG No data
1101853810_1101853816 9 Left 1101853810 12:108425629-108425651 CCCACATGGAGCCCTGAAACATA No data
Right 1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG No data
1101853806_1101853816 25 Left 1101853806 12:108425613-108425635 CCAGCCTCAGCCTGATCCCACAT No data
Right 1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101853816 Original CRISPR ACACATTAGGTCCCACCTTG AGG Intergenic
No off target data available for this crispr