ID: 1101857941

View in Genome Browser
Species Human (GRCh38)
Location 12:108459577-108459599
Sequence CTGTTTTCTGGGAAGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101857941_1101857949 20 Left 1101857941 12:108459577-108459599 CCAGTCCCCTTCCCAGAAAACAG No data
Right 1101857949 12:108459620-108459642 AATGAGGGTTTTACAAGCTTTGG No data
1101857941_1101857948 5 Left 1101857941 12:108459577-108459599 CCAGTCCCCTTCCCAGAAAACAG No data
Right 1101857948 12:108459605-108459627 ACATGTAACATTTTAAATGAGGG No data
1101857941_1101857947 4 Left 1101857941 12:108459577-108459599 CCAGTCCCCTTCCCAGAAAACAG No data
Right 1101857947 12:108459604-108459626 TACATGTAACATTTTAAATGAGG No data
1101857941_1101857950 21 Left 1101857941 12:108459577-108459599 CCAGTCCCCTTCCCAGAAAACAG No data
Right 1101857950 12:108459621-108459643 ATGAGGGTTTTACAAGCTTTGGG No data
1101857941_1101857951 22 Left 1101857941 12:108459577-108459599 CCAGTCCCCTTCCCAGAAAACAG No data
Right 1101857951 12:108459622-108459644 TGAGGGTTTTACAAGCTTTGGGG No data
1101857941_1101857952 23 Left 1101857941 12:108459577-108459599 CCAGTCCCCTTCCCAGAAAACAG No data
Right 1101857952 12:108459623-108459645 GAGGGTTTTACAAGCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101857941 Original CRISPR CTGTTTTCTGGGAAGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr