ID: 1101858686

View in Genome Browser
Species Human (GRCh38)
Location 12:108465003-108465025
Sequence GCTGAGATTTAGACCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101858684_1101858686 -8 Left 1101858684 12:108464988-108465010 CCTCTTACCAGCTGAGCTGAGAT No data
Right 1101858686 12:108465003-108465025 GCTGAGATTTAGACCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101858686 Original CRISPR GCTGAGATTTAGACCCAGAC AGG Intergenic
No off target data available for this crispr