ID: 1101859201

View in Genome Browser
Species Human (GRCh38)
Location 12:108468792-108468814
Sequence CAGGATAAAGACTCTACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101859193_1101859201 -7 Left 1101859193 12:108468776-108468798 CCCAATCCCAAATTCCCAGGATA No data
Right 1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG No data
1101859189_1101859201 18 Left 1101859189 12:108468751-108468773 CCCTCTGGCATTAATCCGTCTTA No data
Right 1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG No data
1101859191_1101859201 3 Left 1101859191 12:108468766-108468788 CCGTCTTAGTCCCAATCCCAAAT No data
Right 1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG No data
1101859190_1101859201 17 Left 1101859190 12:108468752-108468774 CCTCTGGCATTAATCCGTCTTAG No data
Right 1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG No data
1101859194_1101859201 -8 Left 1101859194 12:108468777-108468799 CCAATCCCAAATTCCCAGGATAA No data
Right 1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101859201 Original CRISPR CAGGATAAAGACTCTACATG GGG Intergenic
No off target data available for this crispr