ID: 1101866598

View in Genome Browser
Species Human (GRCh38)
Location 12:108524926-108524948
Sequence CTCCCCTTTATCCAGGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101866598_1101866604 -7 Left 1101866598 12:108524926-108524948 CCATTAACCTGGATAAAGGGGAG 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1101866604 12:108524942-108524964 AGGGGAGGGAGAGTGGGCAGTGG 0: 1
1: 1
2: 24
3: 338
4: 2787
1101866598_1101866605 -6 Left 1101866598 12:108524926-108524948 CCATTAACCTGGATAAAGGGGAG 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1101866605 12:108524943-108524965 GGGGAGGGAGAGTGGGCAGTGGG 0: 1
1: 0
2: 13
3: 195
4: 1704
1101866598_1101866606 29 Left 1101866598 12:108524926-108524948 CCATTAACCTGGATAAAGGGGAG 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1101866606 12:108524978-108525000 AAACCACTTACTACTCAAAATGG 0: 1
1: 0
2: 0
3: 19
4: 180
1101866598_1101866607 30 Left 1101866598 12:108524926-108524948 CCATTAACCTGGATAAAGGGGAG 0: 1
1: 0
2: 0
3: 12
4: 86
Right 1101866607 12:108524979-108525001 AACCACTTACTACTCAAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101866598 Original CRISPR CTCCCCTTTATCCAGGTTAA TGG (reversed) Intronic