ID: 1101866638

View in Genome Browser
Species Human (GRCh38)
Location 12:108525113-108525135
Sequence CAGCCTTCTCCCTCTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 497}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101866638_1101866650 22 Left 1101866638 12:108525113-108525135 CCTGGGACAGAGGGAGAAGGCTG 0: 1
1: 0
2: 7
3: 61
4: 497
Right 1101866650 12:108525158-108525180 CCCGTATGCTGCTGGTCACAGGG 0: 1
1: 0
2: 0
3: 13
4: 110
1101866638_1101866648 21 Left 1101866638 12:108525113-108525135 CCTGGGACAGAGGGAGAAGGCTG 0: 1
1: 0
2: 7
3: 61
4: 497
Right 1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 76
1101866638_1101866645 14 Left 1101866638 12:108525113-108525135 CCTGGGACAGAGGGAGAAGGCTG 0: 1
1: 0
2: 7
3: 61
4: 497
Right 1101866645 12:108525150-108525172 CCCCAAAGCCCGTATGCTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101866638 Original CRISPR CAGCCTTCTCCCTCTGTCCC AGG (reversed) Intronic
900392740 1:2440841-2440863 CATCTCTCTGCCTCTGTCCCTGG + Intronic
900436002 1:2631621-2631643 CAGCCACCTCTCTCAGTCCCTGG + Intronic
900685609 1:3945914-3945936 CACCCCCCTCTCTCTGTCCCTGG + Intergenic
900748042 1:4374626-4374648 CATCATTCTCCCTATGTGCCAGG + Intergenic
900881727 1:5386443-5386465 TAAACTTCTCCCTCTGTTCCTGG - Intergenic
901748088 1:11388025-11388047 CTGCCCTCTCCGTCTCTCCCCGG + Intergenic
901779402 1:11583438-11583460 CCACCTTCTCCCTTTGTCTCTGG - Intergenic
902164974 1:14562845-14562867 CAGCCTTCTCCTGCTTTCCACGG - Intergenic
902261468 1:15228158-15228180 CAGGCTTCTGCCTCTATGCCTGG + Intergenic
902272809 1:15316720-15316742 CAGCCTCCTGTCCCTGTCCCCGG - Intronic
902383826 1:16065259-16065281 CTGCCTTCCCCCACTCTCCCCGG + Intronic
902505987 1:16939238-16939260 CAGACTCCTCCCTCGGACCCTGG - Intronic
902565095 1:17306081-17306103 GAACCTTCTCCCTGTGTTCCTGG + Intergenic
902620292 1:17646838-17646860 CAGCCTCCTCCCTCGGCCACTGG - Intronic
902703687 1:18190235-18190257 CAGCCAGCTCCCTCTTTGCCTGG + Intronic
903203838 1:21765509-21765531 GAGCCTTCTGCCTCAGTCTCTGG - Intronic
903815378 1:26060780-26060802 GAGCCTTCTCCCTGGGTCCCTGG - Intronic
904301075 1:29555364-29555386 GAGCCTCCTACCTCTGGCCCAGG + Intergenic
904807697 1:33143359-33143381 CAGCCTTCTCCCTCTGGGGTCGG - Intergenic
904936078 1:34130669-34130691 AAGCCTTCTCTGTCTCTCCCTGG - Intronic
905699982 1:40004975-40004997 CAGCATTCTACCTCTTTCTCTGG + Intergenic
905809493 1:40901824-40901846 GTGCCTTCTCCTTCTGTCCAAGG + Intergenic
906198753 1:43946451-43946473 CAGCCTCCACCCTCTAGCCCGGG + Intergenic
906712413 1:47940748-47940770 CTGCATCCTGCCTCTGTCCCTGG - Intronic
907296568 1:53459732-53459754 GAGCCTCCGCCCGCTGTCCCCGG + Exonic
907331674 1:53675913-53675935 CAGGCTTCTCTCTCTGGGCCAGG - Intronic
907767193 1:57423524-57423546 CTGCCTTCTCCCGCTGTCCTGGG - Intronic
909612301 1:77564823-77564845 CAGCCTTCTGCCTCTGTATTTGG - Exonic
910135055 1:83957790-83957812 CTGCCTTCTCACTATGTCCTTGG - Intronic
910759894 1:90723673-90723695 CAGCTTTCTCAGTCTCTCCCAGG + Intergenic
912046765 1:105468867-105468889 CTGTCTTCTCCCTGTGTCCCTGG - Intergenic
912725844 1:112058250-112058272 TGGCCTCCTGCCTCTGTCCCTGG + Intergenic
912937052 1:114012727-114012749 CAGCCTCCTCCCTCTCCCCCAGG + Intergenic
913705926 1:121423100-121423122 CACCATTCTCCCTCAGACCCAGG - Intergenic
914512912 1:148350667-148350689 GTGCCTTCACCCTCTGTGCCTGG + Intergenic
915570541 1:156743094-156743116 CACCCTTCTCCCACTCTCCTAGG - Intronic
916608996 1:166371613-166371635 CCTCTTTTTCCCTCTGTCCCAGG + Intergenic
917923162 1:179767519-179767541 GAGCCTTCTCCTTTTTTCCCTGG + Intronic
918675331 1:187277701-187277723 CACCATTCTCCCTTTATCCCAGG + Intergenic
920043038 1:203116276-203116298 CAGCATTCACACTCTGACCCTGG - Intronic
920673471 1:208022750-208022772 CAGCCTGCTCCCTCCTACCCTGG - Exonic
920697143 1:208189528-208189550 CATCCTTCTGCCTCAGCCCCAGG - Intronic
920736881 1:208540987-208541009 CAGACTTCTTCTTCAGTCCCTGG + Intergenic
920842215 1:209564345-209564367 CAGGCTTCTCCTCCTGTCCCAGG + Intergenic
921292324 1:213670252-213670274 CAGCCTCCTCCCTCTGGCTTGGG - Intergenic
922239013 1:223743304-223743326 CAGCCTTCTGCCTCTGACTCAGG + Intronic
922579649 1:226687489-226687511 CAGCCTCTACCCTCTGTCCCTGG + Intronic
922627664 1:227065803-227065825 CATTCTTCTCCCTCTGTCTCTGG - Intronic
923463797 1:234231152-234231174 CACCCTTCCCCGTCCGTCCCCGG - Intronic
923494146 1:234509839-234509861 CAGGCTTATCCCTCCCTCCCTGG + Intergenic
923511390 1:234656827-234656849 CTTCCATCTCCCTCTGCCCCAGG + Intergenic
924194527 1:241591746-241591768 CTCCCTTCTCCCTCTCTCCCAGG - Intronic
1062839736 10:661229-661251 CAGTCTTCTCTCTCTGTTCAGGG - Intronic
1063126693 10:3142388-3142410 CTGCCTTCCCCCTCTCTACCAGG + Intronic
1063198768 10:3767613-3767635 CACCCTTCTCCCTTCCTCCCTGG - Intergenic
1063345861 10:5311982-5312004 CAGCCTCCAGCCTCTGTCTCAGG - Intergenic
1063494482 10:6494320-6494342 CAGCTTTATCCATCTCTCCCTGG + Intronic
1063605325 10:7518486-7518508 GTGCTTTCTCCCTCTCTCCCAGG - Intergenic
1064315684 10:14253908-14253930 CAGCTTTCTCTCTCTCTCACAGG + Intronic
1065179089 10:23106982-23107004 CATCATTCTCTCTCTGACCCTGG + Intronic
1065265127 10:23966687-23966709 CAGTCTTCTTCCTCTTTCTCTGG - Intronic
1065317634 10:24479779-24479801 CAGATTTCTCCCTCTTTGCCTGG - Intronic
1065362965 10:24906488-24906510 CAGCATACTCCCTCTGTGTCTGG - Intronic
1065390035 10:25174368-25174390 CTCCCTTCTCCCTCTTTTCCAGG + Intergenic
1065758618 10:28959924-28959946 CATCCACCTCCCTCGGTCCCTGG - Intergenic
1065880514 10:30033811-30033833 CAGCCTTCTGCCTCTGTGATTGG - Intronic
1066144734 10:32545798-32545820 CAGTCTTCTGCCTCAGTCTCTGG - Intronic
1066451427 10:35533535-35533557 CACCCAGCTCCCTCTGTCCCAGG + Intronic
1067291996 10:44950375-44950397 CAGCCTTCTCTGTAAGTCCCAGG - Intergenic
1067970815 10:50968416-50968438 GAGCCTGCTCCCTCTTTCCTAGG + Intergenic
1068579625 10:58724612-58724634 CAGCCATTTCACTCTGTTCCTGG + Intronic
1068837954 10:61576126-61576148 CACCCTTCTTCCTCTGCCCTTGG + Intergenic
1069576718 10:69535896-69535918 CAACTCTCTCCCACTGTCCCAGG + Intergenic
1069617211 10:69813810-69813832 CAGCCCTCTCCTGCAGTCCCTGG + Intronic
1069780832 10:70954382-70954404 CAGCCTCCTCCCTCTCACCCCGG + Intergenic
1070284493 10:75073101-75073123 GAGAATTCTCCCTGTGTCCCAGG - Intergenic
1070306041 10:75239718-75239740 CAGCCTGCCCCCTCTCTGCCTGG - Intergenic
1070574211 10:77665272-77665294 CACCCTGTTTCCTCTGTCCCTGG - Intergenic
1070825439 10:79387866-79387888 CACCCTTCTGCCCCTGGCCCAGG + Intronic
1071570560 10:86694464-86694486 TAGCTTCCTCCCTCAGTCCCAGG + Intronic
1072922805 10:99590859-99590881 CAGGGTTCTGCCTCTGTCCTCGG - Intergenic
1073335120 10:102701365-102701387 GTGCCTTCTCCTTCTGTGCCAGG - Intronic
1073385622 10:103125922-103125944 CAACTTTCTTGCTCTGTCCCAGG + Intronic
1073983957 10:109186951-109186973 CAGCCATGTAACTCTGTCCCAGG - Intergenic
1074285621 10:112095102-112095124 CTGCCTTCAACCTCTTTCCCTGG + Intergenic
1074813710 10:117129146-117129168 CAGCCTCCTGCATCTGGCCCAGG - Intronic
1075087185 10:119421574-119421596 CTGCCTTCCCACTCTGCCCCAGG - Intronic
1075106528 10:119543106-119543128 CCGCCTTCTCCCTGTAGCCCCGG + Intergenic
1075245320 10:120817428-120817450 CAGCATTCTCTCTCTGCCTCAGG + Intergenic
1075396073 10:122128099-122128121 CAGCCTTGTCCCTCGCTCTCAGG - Intronic
1075472594 10:122704063-122704085 CGGCCATCTCCCTCTCTCCAAGG + Intergenic
1075717746 10:124566748-124566770 CAGCCTCCTCCCTCTGTCTCAGG - Intronic
1075757949 10:124830538-124830560 CATGCTTCTCCCTTTGCCCCAGG - Intronic
1075975375 10:126689630-126689652 GAGCCTTTTCCCCCTGTTCCTGG + Intergenic
1076199208 10:128545074-128545096 CATCCTCCTCCCCCTGCCCCTGG + Intergenic
1076571899 10:131438650-131438672 CAGCCTCCAGCCTCTGTCCAGGG - Intergenic
1077096611 11:801728-801750 GATCCTGCTCCCTGTGTCCCTGG - Intronic
1077246449 11:1541606-1541628 CAGCGTCCCCTCTCTGTCCCAGG + Intergenic
1077303929 11:1859505-1859527 CTGCCTCCTCCTCCTGTCCCAGG + Intronic
1077307330 11:1874137-1874159 CGGCCTGCCCCCACTGTCCCCGG - Intronic
1077307366 11:1874239-1874261 CAGCCTGCCCCCACTGTCCCCGG - Intronic
1077307399 11:1874319-1874341 CAGCCTGCCCCCACTGTCCCCGG - Intronic
1077722980 11:4646088-4646110 CTGCCTTCCCTCTCTGTGCCTGG + Intronic
1079107512 11:17580972-17580994 CACTCTTCTCTCTTTGTCCCTGG - Intronic
1079315535 11:19405013-19405035 CTGCCTTTTGCCTCTGTCCTTGG - Intronic
1080997943 11:37627533-37627555 CCTCCATCTCCCTCAGTCCCTGG + Intergenic
1081964344 11:47160639-47160661 CAGCCTTCTCCTCTTGCCCCTGG + Intronic
1082937800 11:58672485-58672507 CTGTCTTATCCCTCTCTCCCTGG + Intronic
1083234607 11:61343599-61343621 CAGCCTTCTCCAGCTCTCACTGG + Intronic
1083247020 11:61436576-61436598 CAGTCTTCTCTTTCTGTCTCAGG + Intronic
1083637118 11:64126737-64126759 AGGCCTGCTCCCTCTGACCCGGG - Intronic
1083935398 11:65867303-65867325 CAGCCTGCTCTGTCTGACCCAGG + Intronic
1084736603 11:71109301-71109323 CAGACATCACCCACTGTCCCTGG - Intronic
1085529814 11:77184566-77184588 CTGTCCTCTCCCTCTGGCCCAGG + Exonic
1085710987 11:78829111-78829133 CAGCCTTCCTCCTGGGTCCCTGG + Intronic
1087567209 11:99876425-99876447 CTGCATTCTCCCTTTGTTCCAGG + Intronic
1088576514 11:111277541-111277563 CTGCCTCCTGCCTCTGCCCCAGG - Intronic
1088882250 11:113981367-113981389 CAATCTTGTCTCTCTGTCCCCGG - Intronic
1088928494 11:114325720-114325742 CAGCCTTGTCCCTCTGCTGCTGG - Intergenic
1088941295 11:114459744-114459766 CAGCCTTCTTCCCATGTTCCTGG - Intergenic
1089555196 11:119312228-119312250 CAGCCTGGTCCCCCTGTCCTGGG + Intronic
1090203917 11:124874732-124874754 CAGCCCTATCTCCCTGTCCCTGG + Intronic
1090477542 11:127037213-127037235 CAGCCTCCTGCCTGTGTCACAGG + Intergenic
1090950903 11:131472332-131472354 TAGCCATTTCTCTCTGTCCCTGG - Intronic
1090959964 11:131547375-131547397 CAGCATTCTCTCTCTGTCCAAGG - Intronic
1091283515 11:134395608-134395630 CAGACTTCTCCCCCAATCCCAGG - Intronic
1091689854 12:2588453-2588475 CTGCCCTCTCCCTCTCTCCTGGG + Intronic
1091909334 12:4216080-4216102 CCGCCTTCTCTCTGTCTCCCGGG - Intergenic
1096650081 12:53058294-53058316 CAGCCTCCTGCCTTTCTCCCAGG + Exonic
1097153706 12:56997351-56997373 TGTCCTTCACCCTCTGTCCCCGG + Intergenic
1097190666 12:57217970-57217992 CAGCCATCTGCCTATGCCCCTGG + Intronic
1097382057 12:58907122-58907144 CAGGCATCTTCCACTGTCCCAGG + Intronic
1098226431 12:68329839-68329861 ATGCCTCCTCCCTGTGTCCCAGG - Intronic
1099629793 12:85127997-85128019 CAGCCTTCTCCCTCTGTTTTCGG - Exonic
1099856288 12:88171362-88171384 CAACCTTCTCCCTCCAACCCTGG + Intronic
1100950930 12:99848302-99848324 CTTCCTGTTCCCTCTGTCCCTGG - Intronic
1100956850 12:99918081-99918103 CAGCCTCCCACCTCTGTCCATGG + Intronic
1101131462 12:101695508-101695530 CAGTAGTCTCCCTTTGTCCCTGG - Intergenic
1101866638 12:108525113-108525135 CAGCCTTCTCCCTCTGTCCCAGG - Intronic
1102679932 12:114684541-114684563 CTGCCTCCTCCCTCGATCCCCGG - Intergenic
1103215015 12:119195286-119195308 CAGCCTCCTCCCGCTGTTTCCGG - Intronic
1103742724 12:123102172-123102194 CAGCCTTCTCCCTCCTGCTCTGG - Intronic
1104277654 12:127344446-127344468 CACCCCTCTCCCTCTTGCCCCGG - Intergenic
1104719783 12:131038913-131038935 CACCCTGCTCCATCTGCCCCAGG - Intronic
1105253734 13:18725549-18725571 CAGCCAGCTCCCCATGTCCCTGG - Intergenic
1106191562 13:27458092-27458114 TAGCCATCTTCCTCTTTCCCAGG + Intergenic
1107114217 13:36729235-36729257 CAGCTTCCTCCCACTTTCCCTGG + Intergenic
1108263373 13:48679984-48680006 CAGTTTTCCCCCTCTGTCTCAGG + Intronic
1108356076 13:49629853-49629875 CATCCTTCTCACTCTGTGCATGG + Intronic
1108817763 13:54313041-54313063 GAGCCGGCTCCCTCTGTTCCTGG + Intergenic
1109248571 13:59988881-59988903 CAGCCCCCTCCCTTTTTCCCAGG + Intronic
1110013218 13:70365488-70365510 CAGCCTTTTCCTTTTGTGCCTGG + Intergenic
1110723073 13:78787461-78787483 GAGCCTGCTCTCTCTGTCTCTGG + Intergenic
1111676900 13:91399079-91399101 CTGCCTCCTCCTTCTGGCCCTGG + Exonic
1112297628 13:98202191-98202213 CCACCTTGTGCCTCTGTCCCGGG - Intronic
1112440809 13:99423352-99423374 CAGGCTCCTCCCTGTGACCCTGG - Intergenic
1113376265 13:109767214-109767236 CAGCCTCTGGCCTCTGTCCCTGG - Intronic
1113775687 13:112943654-112943676 CCGCCTTCCCCGTCTGTCCCCGG - Intronic
1115203195 14:30874894-30874916 CCGCATTCTCCCTCTCTCCCAGG + Exonic
1115323461 14:32110910-32110932 CAGCCTTCTCCATCTGTTTTTGG - Intronic
1116203069 14:41824761-41824783 CAGCTTTGTCCCTCTCTCCAAGG - Intronic
1117120191 14:52559267-52559289 CTGCCTTCTCTCTCTCTTCCCGG - Intronic
1117994558 14:61466666-61466688 CAGCCCTCTCACCCAGTCCCAGG - Intronic
1118369870 14:65128867-65128889 CAGCCTTCTTCCTGCCTCCCGGG - Intergenic
1118505076 14:66402419-66402441 AACCCTTCTCCCACTATCCCTGG + Intergenic
1118636864 14:67755908-67755930 CTGCCTTCTACCTCTGTTGCTGG - Intronic
1118838123 14:69490925-69490947 CTGGCTTCTCCCTCTTCCCCGGG - Intronic
1119657432 14:76427173-76427195 CATCTTACTGCCTCTGTCCCTGG + Intronic
1119749089 14:77064899-77064921 CTGCCTCCTGCCTCTGTGCCTGG - Intergenic
1119776614 14:77253127-77253149 CAGCCTTCTCTCTGTCCCCCTGG + Intronic
1119862386 14:77945831-77945853 CACCTCTCTCTCTCTGTCCCTGG + Intergenic
1121083508 14:91127527-91127549 CGGCCTCATCCCTCTGGCCCAGG - Intronic
1121494410 14:94381918-94381940 AAGCCAGCTCCCACTGTCCCAGG - Intronic
1122292473 14:100687084-100687106 CAGGCCTCTTCCTCTCTCCCTGG + Intergenic
1122461964 14:101903437-101903459 CAGCCTTCATGCTCTGTTCCTGG - Intronic
1123053563 14:105559218-105559240 CAGCCTCCGGCCACTGTCCCTGG - Intergenic
1123078141 14:105679633-105679655 CAGCCTCCGGCCACTGTCCCTGG - Intergenic
1124076827 15:26454090-26454112 CCTCATTCTCCCTCTGTCCTTGG - Intergenic
1124388276 15:29227646-29227668 CCGTCTTCTCCTTCTCTCCCTGG - Intronic
1125084192 15:35711512-35711534 CAGCCTTCTACCTCTCCTCCTGG - Intergenic
1125677885 15:41512166-41512188 CAATCTTCTCCCTCGGTCTCGGG - Exonic
1126875498 15:53036970-53036992 CAGCCTTGCCCCTCTGTCTTTGG + Intergenic
1127146709 15:56032514-56032536 CAGGCTTCTCCCTCAGGCCCAGG + Intergenic
1127274070 15:57426911-57426933 CAGCCTTCATCTTCTGCCCCAGG - Intronic
1127311129 15:57753157-57753179 CTGCCTCCTCCCTGTGCCCCAGG + Intronic
1127719928 15:61689330-61689352 CCACCTTCTCCCTTTGTCTCTGG + Intergenic
1127852795 15:62928662-62928684 CCTCCTTATCTCTCTGTCCCCGG + Intergenic
1128053373 15:64682424-64682446 CAGCTTGCTCCCAGTGTCCCTGG - Exonic
1128755654 15:70181941-70181963 CACCCAACTCCCTATGTCCCAGG - Intergenic
1129154986 15:73712259-73712281 CAGCCTGCCCCCTCAGTCTCTGG + Intronic
1129392743 15:75228769-75228791 GAGCTGCCTCCCTCTGTCCCAGG + Intergenic
1129738780 15:77979905-77979927 CAGCTTTCTCCTCCTGACCCTGG + Intergenic
1130384843 15:83402023-83402045 GAGCATTATCCCTCTGTCTCTGG - Intergenic
1130903612 15:88225123-88225145 CTGCCATCACCCTCTGGCCCAGG - Intronic
1131019682 15:89087898-89087920 GACCCTTCTTCCTCTCTCCCGGG + Intronic
1132576285 16:665872-665894 CCGCCTCCTCCCTCTGGCCTGGG + Intronic
1132657672 16:1048176-1048198 CCACCTCCTCCCTCTGTCTCTGG + Intergenic
1132879980 16:2157839-2157861 CAGCCTGCTGGCTGTGTCCCTGG + Intronic
1132903547 16:2271018-2271040 CATCCTCATCCCTGTGTCCCAGG - Intergenic
1133115517 16:3576092-3576114 CACCCCTCTTCTTCTGTCCCAGG - Intronic
1133290072 16:4714475-4714497 CAGCCTTCACCTTCTGCGCCTGG + Intronic
1133322200 16:4921334-4921356 CAGCCATCTTCTTGTGTCCCAGG + Intronic
1134072934 16:11272006-11272028 CAGCCTTGTCCTTTTGTCCAAGG - Intronic
1134453688 16:14378961-14378983 CAGCCCTCTCCACCTGCCCCAGG + Intergenic
1135427703 16:22353530-22353552 CTGCCTCCTCCCTCTCTACCAGG + Intronic
1135508415 16:23059569-23059591 CACCCTTTTCCCTGTGTCTCTGG + Intergenic
1136248785 16:28990105-28990127 CTGGCTTGTCCCTCTGTCTCTGG + Intronic
1136613200 16:31379765-31379787 CAGGCAGGTCCCTCTGTCCCAGG - Exonic
1137336434 16:47554126-47554148 CTGCCCCTTCCCTCTGTCCCAGG + Intronic
1137597887 16:49736983-49737005 GTGCCACCTCCCTCTGTCCCTGG - Intronic
1137693418 16:50445713-50445735 CAGCCTTCCCCCTCTGTGCCTGG - Intergenic
1138054177 16:53815040-53815062 CAGCTGTCTCCCTCTGCTCCAGG - Intronic
1138193649 16:55036420-55036442 CACCCTTGGCCCCCTGTCCCGGG - Intergenic
1138194630 16:55043289-55043311 CAGCCCTATCCCTGTGTCCCAGG - Intergenic
1138386338 16:56638222-56638244 CAGCCTCCTGCTCCTGTCCCCGG - Intergenic
1138638906 16:58367044-58367066 CAGCCCTCTTCCTGTGTGCCTGG - Intronic
1138943072 16:61813571-61813593 CAGGCTTCTCCCCCTGCCCGTGG - Intronic
1139711983 16:68782809-68782831 CATCCTTGCCCCTCCGTCCCTGG + Intronic
1139786924 16:69400791-69400813 CAGCTCTCTCTCTCTCTCCCTGG + Intronic
1140249540 16:73283841-73283863 GAGCCTCCTGCCTCTGCCCCTGG - Intergenic
1140905642 16:79406844-79406866 CTTCTTTCTTCCTCTGTCCCAGG - Intergenic
1141145878 16:81529664-81529686 CTCCCACCTCCCTCTGTCCCTGG - Intronic
1141459554 16:84169925-84169947 CTGCCTTGTTTCTCTGTCCCCGG - Exonic
1141482031 16:84313160-84313182 CAGCCCCCTCCCTCGGGCCCAGG - Intronic
1141495562 16:84407214-84407236 CAGCCCTGTTCCTCTGTCTCAGG + Intronic
1142244475 16:88963217-88963239 TGGCCTTCCCCCACTGTCCCTGG - Intronic
1142863279 17:2776410-2776432 CAGGCTGCTCCTTCTCTCCCCGG + Intergenic
1142885610 17:2910503-2910525 AAGCCTTCTCCCACTGCCCGAGG - Intronic
1143096896 17:4483046-4483068 CTGCGTTCTCCCCCTGCCCCAGG + Intronic
1143457605 17:7078045-7078067 CTGCCATCTCCTGCTGTCCCTGG - Exonic
1143628899 17:8126017-8126039 CACCCCCCTCCCTCCGTCCCCGG + Intergenic
1143742556 17:8965284-8965306 CAGCCTCCTGCCTCTGACACAGG - Intronic
1144556568 17:16287433-16287455 CTGCCTTCTCCATCTGTCAGTGG + Intronic
1144778372 17:17796050-17796072 CAGCCCCTTCCATCTGTCCCTGG - Exonic
1144859821 17:18294147-18294169 CAGCCATCTCCCTGTGGCCCTGG - Intronic
1145195528 17:20890591-20890613 CATCCTTCTGCCTCTTTACCTGG + Intronic
1146669101 17:34724560-34724582 GAGCTTTCTTCCTCTGGCCCAGG - Intergenic
1146799081 17:35804352-35804374 CAGGCTTCTGCCACTGTGCCCGG - Intronic
1147286158 17:39403648-39403670 CTGTCTTCTCCTCCTGTCCCAGG + Intergenic
1147893537 17:43734461-43734483 CTGCCTGCTCTCTCTCTCCCTGG + Intergenic
1147904508 17:43814091-43814113 CAGCCTTCTTCTTGTTTCCCAGG - Exonic
1148080611 17:44966083-44966105 CTGCCTTTTCCATCTCTCCCTGG - Intronic
1148091166 17:45023228-45023250 CAGGCTTCTCCCTGGGTCCCAGG - Intergenic
1148578085 17:48725317-48725339 TGGCCTTTTCCCTCAGTCCCGGG + Exonic
1148847731 17:50539034-50539056 CAGCCTCCTCCCGCTGTACCCGG + Intronic
1148861888 17:50608840-50608862 CACCTGTCTCCCTCTCTCCCGGG + Intronic
1149122450 17:53185772-53185794 CCACCTTCTTCCACTGTCCCTGG - Intergenic
1149294843 17:55252812-55252834 CATGTTTCTCCCTCTCTCCCTGG - Intergenic
1149865869 17:60150736-60150758 CAGCCTCCTCCGTCTGCCCGTGG + Intronic
1150119962 17:62592679-62592701 AAACCATCTCCCCCTGTCCCCGG - Intronic
1150124695 17:62628328-62628350 CAGTCTCCTCGCTCTGCCCCAGG + Intronic
1150641798 17:66954260-66954282 CAGCCAACTCTCTCTGTCCCCGG - Intergenic
1151177509 17:72300928-72300950 CATCCCTCTCCCTGTCTCCCTGG - Intergenic
1151566917 17:74903798-74903820 CTCTCCTCTCCCTCTGTCCCTGG - Intergenic
1151595318 17:75074846-75074868 CAGCCCTCTGCCTCTGGCTCAGG + Intergenic
1152210010 17:78998104-78998126 CAGACATCACCCTCCGTCCCTGG + Intronic
1152491936 17:80640801-80640823 CTCCCTTCTTCCTCTGTCCGTGG + Intronic
1152618428 17:81348558-81348580 CATCCCCCTCCCACTGTCCCAGG - Intergenic
1152717607 17:81907431-81907453 CACCCTCCTCCCTCTGTCCCTGG - Intronic
1203166509 17_GL000205v2_random:102007-102029 CTGGCTTCTCCTTCTGTTCCTGG - Intergenic
1156491951 18:37501559-37501581 CCTCCATATCCCTCTGTCCCAGG - Intronic
1156748456 18:40421007-40421029 CAGCCTCCTGCCTCTGTTCCTGG + Intergenic
1157046534 18:44107091-44107113 CAGCCTTCTCCATGGGACCCAGG + Intergenic
1157166370 18:45361698-45361720 CAGCCCTCTCCCTCTCGGCCAGG + Intronic
1157544835 18:48540037-48540059 CAGCCCCCTCCCTGCGTCCCCGG + Intronic
1157565650 18:48677327-48677349 CAGGCATCTCTCTGTGTCCCAGG + Intronic
1157807982 18:50672549-50672571 GAGGCTCTTCCCTCTGTCCCTGG + Intronic
1157977474 18:52342239-52342261 CTGCCTGCTCTCTCTGTCTCTGG - Intronic
1158041167 18:53095965-53095987 CAGCCTTCAGCCACTGTGCCTGG - Intronic
1160121011 18:76130562-76130584 CTGCCCTCACCCTCTGTCCTGGG + Intergenic
1160522107 18:79513680-79513702 CGGTCTCCTCCCTCTGACCCAGG + Intronic
1160775223 19:852417-852439 CCCGCTGCTCCCTCTGTCCCGGG + Intronic
1160915314 19:1493505-1493527 CAGCCTTCTTCCTCCTCCCCTGG - Intronic
1161158943 19:2750929-2750951 CAGACATCGCCCTGTGTCCCGGG + Intergenic
1161270514 19:3387073-3387095 CCTCCCTCTCCCTCTATCCCAGG - Intronic
1161323206 19:3650658-3650680 CTGCCTGGTCCCTCTGCCCCTGG + Intronic
1162018240 19:7857049-7857071 CTGCCTCCTCCCCCTGTCGCTGG + Intronic
1162733199 19:12731261-12731283 CAGCCTTCTCCCTCCCTGTCTGG - Intronic
1162838892 19:13341140-13341162 TGGCCTTCTCCCTCTGTGCAAGG - Intronic
1163613481 19:18312533-18312555 CAGCCTCCTCCCTCCCTCCCTGG - Intronic
1163745341 19:19043394-19043416 CAGCCCCCTGCCTCTGCCCCAGG - Intronic
1165167940 19:33870505-33870527 CAGCCAGCTCCATGTGTCCCAGG - Intergenic
1165982174 19:39734183-39734205 CAGATAACTCCCTCTGTCCCCGG - Intronic
1166305436 19:41934752-41934774 CAGCCTCCTTCCTCAGACCCAGG - Intergenic
1166306211 19:41938366-41938388 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1166306332 19:41938702-41938724 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1166306528 19:41939258-41939280 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1166306541 19:41939296-41939318 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1166388643 19:42396691-42396713 CCCCCTCCTCCCTCTGACCCAGG + Intergenic
1166506188 19:43373127-43373149 GCCCCTTCTCCCTCAGTCCCAGG + Intergenic
1166523974 19:43499439-43499461 GCCCCTTCTCCCTCTGTCCCAGG - Intronic
1166571170 19:43798134-43798156 CAGGCTTCTCCCTCAGACCAGGG + Intronic
1166662122 19:44654098-44654120 GCCCCTTCTCCCTCAGTCCCAGG - Intronic
1166679658 19:44758944-44758966 TAGCCTCCTCCCTCTGACCCAGG + Intronic
1166688459 19:44809477-44809499 CTGCCTCCTCCCTCAGACCCTGG + Intronic
1166713264 19:44950697-44950719 CACCATTCTCCCTCTGCCACGGG - Intronic
1167249324 19:48392143-48392165 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1167249337 19:48392178-48392200 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1167276664 19:48543965-48543987 CAGCCTCCTCCCTCAGATCCAGG + Intergenic
1167276690 19:48544037-48544059 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1167276741 19:48544183-48544205 CAGCCTCCTCCCTCAGACCCAGG + Intergenic
1167278191 19:48551607-48551629 CTGCCCTCTCCCTTTCTCCCTGG + Intergenic
1167367908 19:49064509-49064531 CACCCTTCTCCCTCAGACCCAGG + Intronic
1167367925 19:49064556-49064578 CACCCTTCTCCCTCAGACCCTGG + Intronic
1167367949 19:49064632-49064654 CGCCCTTCTCCCTCAGACCCAGG + Intronic
1167425497 19:49427816-49427838 AACCCTTCTCCCTCAGACCCAGG - Intronic
1167752121 19:51387614-51387636 CATCCTCCTCCCTCAGACCCAGG - Intronic
1168254435 19:55157948-55157970 CCTCCTCCTCCCTCAGTCCCAGG + Intronic
1168306222 19:55437786-55437808 CAGCTTCCTCCCTCAGACCCAGG + Intronic
925014164 2:509284-509306 CAGCCTTCTTCCTGCGTCCTTGG - Intergenic
925164178 2:1705408-1705430 CATCCTGCACCCTGTGTCCCAGG - Intronic
925164195 2:1705473-1705495 CACCCTGCACCCTGTGTCCCAGG - Intronic
925830624 2:7891001-7891023 CAGGTTTCTCCATCTGTTCCTGG + Intergenic
925987127 2:9225686-9225708 CAGCCTGCTCCATCTCCCCCAGG - Intronic
926055932 2:9774001-9774023 CAGGCCTCTCCCTCTGTGTCTGG + Intergenic
926095509 2:10079112-10079134 GAGCTCTCTCCCTCTGGCCCTGG - Intronic
926414295 2:12633859-12633881 ATGACTTCTCCCACTGTCCCAGG - Intergenic
926912840 2:17867201-17867223 CAGGATTCTCCTTCTGACCCTGG + Intergenic
927313710 2:21658154-21658176 GGGCCTTCTCCCACTGTCACTGG - Intergenic
927462974 2:23315188-23315210 CTGCTGTCTCCATCTGTCCCAGG - Intergenic
927495078 2:23546637-23546659 GAGGCTTCTCCCCCTCTCCCGGG + Intronic
927639787 2:24839357-24839379 CAGCCTTCCCCATCTGGGCCAGG - Intronic
927980213 2:27370308-27370330 CAGCCATCGCCCTCAGTCCTAGG + Intronic
929055946 2:37875883-37875905 CAGCCTTCTCCCTATCTCCCAGG - Intergenic
929587118 2:43123630-43123652 GAGACTTCTACCTCTGCCCCGGG + Intergenic
929910982 2:46089372-46089394 CAGCCTTCTCCCTTCTTCCCTGG + Intronic
930054544 2:47241876-47241898 CAGCCTCCTCTCCCTGTCCCTGG + Intergenic
930464159 2:51723929-51723951 AATCCTTCATCCTCTGTCCCTGG - Intergenic
930652595 2:53977415-53977437 CAGCCTTCAACTTCTATCCCTGG + Intronic
931695815 2:64869694-64869716 CAGCCTTCTTCCCCAGTCCCAGG - Intergenic
931744323 2:65278761-65278783 CAGGCTCCTCCCTCTGCTCCTGG - Intergenic
932598749 2:73110368-73110390 CAGCCCTCCCCCTCTGTCAGTGG + Intronic
934487977 2:94735753-94735775 CAGCCAGCTCCCCATGTCCCCGG - Intergenic
934559196 2:95303583-95303605 CAGCCTTCCCCCGCTCTCCTGGG + Intronic
934757286 2:96832901-96832923 CAGCCTTCCCCTTCTCCCCCGGG + Exonic
936789454 2:116133811-116133833 CACCCTTGTCCCTCGGGCCCTGG - Intergenic
937075924 2:119106506-119106528 GAGCCTGCTCCTTCTGGCCCAGG + Intergenic
937103585 2:119290251-119290273 CAGCCTCCTCCATTTGGCCCAGG - Intergenic
937619917 2:123973485-123973507 CAGGCTTCTCCCTTTCTTCCCGG - Intergenic
937688444 2:124724597-124724619 CAGCTTTCTCCCTCTCTCCCTGG + Intronic
938077313 2:128346664-128346686 CAGCCCTGTCCCTCCGTTCCTGG + Intergenic
938389644 2:130894724-130894746 GCTCCTTCTTCCTCTGTCCCTGG + Intronic
939423573 2:142004769-142004791 CAGCCTTCACCTTCTCTTCCCGG - Intronic
941436045 2:165474382-165474404 CAGGCTTATACCACTGTCCCTGG + Intronic
942627274 2:177915352-177915374 CCTCCTTCTCCCTCAGTCTCTGG + Intronic
942675883 2:178426630-178426652 CTGCCTCCTCCCTTTGTCTCTGG + Intergenic
943064807 2:183074311-183074333 CTGTCTTCTCCCTCTGGCCTGGG + Intergenic
944770670 2:202911399-202911421 CAGCCTTCTCTCCCTTCCCCAGG - Intronic
946385823 2:219383953-219383975 CAGCCTTCTCCCTGTTTCTTGGG - Intronic
946408494 2:219505206-219505228 CAGCATTCTTCCTCTCTGCCAGG + Exonic
947743159 2:232494174-232494196 CAGGCTTCTCTGCCTGTCCCAGG - Intergenic
947915354 2:233828845-233828867 CAGCCTGCACCCTCCCTCCCAGG - Intronic
948846260 2:240684132-240684154 CAGCCCTTTCCCTCTCCCCCAGG + Intergenic
948935558 2:241161984-241162006 CAGCATTCTCTGTCTGTCCTGGG + Intronic
949031667 2:241800047-241800069 CAGCCTTCTCCCTGGTGCCCAGG - Intronic
1168736543 20:144170-144192 CTGATTTCTCCCTCTGTCTCTGG + Intronic
1168779021 20:473103-473125 CAGCCTGCACCCTCAGTCCAAGG - Intergenic
1169661954 20:7988947-7988969 CAGCCCACTCCCTCTGCCTCCGG - Intronic
1171239166 20:23551227-23551249 CAGTCTTCACCCTCAGCCCCAGG - Intergenic
1171480533 20:25452522-25452544 CAGCCTCCTCCCTCTTCCCGGGG - Intronic
1172250473 20:33475858-33475880 AACCCTCCTCCCTCTGTGCCTGG - Intergenic
1172438538 20:34948355-34948377 CATCCCTCTGCCTCTGTCCCAGG + Intronic
1172519365 20:35557141-35557163 CATCCTCCTCCCTCAGGCCCAGG - Intronic
1172930874 20:38585826-38585848 CAGCCTTCTTTCTTGGTCCCTGG + Intronic
1172966682 20:38840460-38840482 CTGCCATCACCCTCTGCCCCAGG + Intronic
1173024403 20:39294611-39294633 CCACCTCCTCCCTCTGTCTCTGG + Intergenic
1173437696 20:43047749-43047771 CAGCTTACTCACTCTGTGCCAGG + Intronic
1173847674 20:46198376-46198398 GACCCTTCTCCATCTCTCCCCGG + Intronic
1173859294 20:46271783-46271805 CAGACTCCTCACTCTTTCCCTGG + Intronic
1174131121 20:48343995-48344017 AATCCCTCTCCCTCTTTCCCAGG - Intergenic
1174365491 20:50053934-50053956 CAGACCTCTCCCTTTGTGCCAGG + Intergenic
1175383576 20:58580120-58580142 TAGGCTGCTCCCTATGTCCCTGG + Intergenic
1175970918 20:62686447-62686469 GTGTCTTCTCACTCTGTCCCCGG - Intergenic
1176104776 20:63380829-63380851 AAGGCTTCTCCCTTTGTCACGGG - Intergenic
1176405246 21:6357089-6357111 CTGGCTTCTCCTTCTGTTCCTGG + Intergenic
1176431911 21:6632014-6632036 CTGGCTTCTCCTTCTGTTCCTGG - Intergenic
1176839243 21:13825545-13825567 CAGCCAGCTCCCCATGTCCCTGG - Intergenic
1178137994 21:29649951-29649973 CGTGCTTCTCCCTCTGTCTCTGG + Intronic
1178431268 21:32520589-32520611 CAGCCTTCTCCATGAGTCCCTGG + Intergenic
1179682104 21:43029933-43029955 CAGCCTTCAGTCTCTGTCCTCGG + Exonic
1180023763 21:45146641-45146663 CTGCCTTCTCCCTCTGGGTCAGG - Intronic
1180937210 22:19633582-19633604 TCGTCCTCTCCCTCTGTCCCGGG - Intergenic
1180941980 22:19665680-19665702 GTGCCTGCTCCCTCTGTGCCTGG - Intergenic
1181419900 22:22790467-22790489 GAGGCTTCTCCTCCTGTCCCGGG - Intronic
1182521142 22:30885114-30885136 CTGCCTTGTCCCTGTGTCACAGG + Intronic
1182830371 22:33300153-33300175 CAGCCTGCTCACTCTGTCGAAGG - Intronic
1183031696 22:35111240-35111262 CAGCCTTCTCTTCCTGTCTCTGG - Intergenic
1183930838 22:41235264-41235286 CAGCCTTCACCCTCTGGCCACGG + Exonic
1184457325 22:44618571-44618593 CTCCCTTCTCCCTCTGCACCTGG - Intergenic
1184928510 22:47661571-47661593 CAGTCTTCTTCCACTGCCCCTGG - Intergenic
1185050875 22:48553402-48553424 CATCCTATTCCCTCTGGCCCGGG - Intronic
1185073428 22:48669609-48669631 ATGCCTTCTCCATCTGTCCCAGG + Intronic
1185103115 22:48852249-48852271 TGGTCTTCTCCCTCTGTCCTTGG + Intergenic
1185194820 22:49462570-49462592 CAGCGTCCTCCTTCTGTCCCAGG + Intronic
949247414 3:1941680-1941702 AATCCTCCTCCCTCTGTCACCGG - Intergenic
949742654 3:7254000-7254022 CAGCTTTCTCCCTCCAACCCTGG + Intronic
950510059 3:13420475-13420497 AAGCCTTCTCCCTCAGCTCCGGG - Intergenic
950553715 3:13682692-13682714 CAGCCCCCTCCGTCTGCCCCAGG + Intergenic
950663134 3:14479315-14479337 CAGCCTTCCTCCCCTCTCCCAGG - Intronic
953405203 3:42656518-42656540 CATCCATCTCCCTCTGTCCCAGG - Intronic
953576893 3:44119985-44120007 CATCCTCCTCCCTCCTTCCCAGG + Intergenic
953929050 3:46996905-46996927 CCCCCTCCTCCCTCTGACCCTGG + Intronic
954364733 3:50139786-50139808 CAGCCTTCTCCCTCAGTATCTGG + Intergenic
954655378 3:52191188-52191210 CAGCCTGGTCGCTCTGTCCTAGG + Intergenic
954751458 3:52816535-52816557 CAGCCTTCTGACTCTGGGCCAGG + Intronic
954751550 3:52817020-52817042 CAGCCTTCTCCCTCTCATACTGG + Exonic
954952858 3:54490482-54490504 GAGCCTTCCCACTCTCTCCCTGG - Intronic
957175839 3:76808400-76808422 CCTCCTTCCTCCTCTGTCCCAGG + Intronic
957728981 3:84107234-84107256 CAGCCTCCTGCCTCAGTCTCCGG - Intergenic
958875634 3:99613567-99613589 CAGCCTTCCCCCCGAGTCCCTGG - Intergenic
960262248 3:115581038-115581060 CATCCTGCCCCCTCTTTCCCGGG - Intergenic
960742275 3:120847852-120847874 CAGCCCTCTTCCTCTACCCCAGG - Intergenic
961119898 3:124365001-124365023 CAGCCTTATCCCTCCTGCCCTGG + Intronic
961153663 3:124660928-124660950 CAGCCTTCTCACTGTATCTCAGG - Intronic
961497763 3:127306719-127306741 CACCCTCCTTCCTCTGTCCCTGG + Intergenic
961682259 3:128607338-128607360 CAGCCAGATCCCACTGTCCCTGG - Intergenic
961743313 3:129047098-129047120 CAGCTTCGTCCCTTTGTCCCAGG + Intergenic
962960950 3:140310348-140310370 CAGCACACTCCCTCTGGCCCAGG + Intronic
964452625 3:156826455-156826477 CAGCTTTCTGGCTCTCTCCCCGG - Exonic
964926515 3:161964372-161964394 CAGCCATATCATTCTGTCCCTGG - Intergenic
966218456 3:177527045-177527067 CAGCCTTCTTCCTCTACCCCAGG + Intergenic
967886526 3:194337140-194337162 CACCCTCCTCACTCTGCCCCAGG - Intergenic
968442221 4:629720-629742 CACCCTCCTCCCTCTATCTCCGG - Intronic
968445105 4:648519-648541 CTCCCCCCTCCCTCTGTCCCGGG + Intronic
968613076 4:1565870-1565892 CAGCCTCCTCCATCCGTCCCTGG + Intergenic
969408929 4:7015170-7015192 AAGCCTTCTCCCACTCCCCCTGG - Intronic
969515153 4:7643339-7643361 CAGCCTGTTTCCTCTGTGCCTGG + Intronic
969839370 4:9869440-9869462 CAGTCTCCTGCCTCTGGCCCTGG + Intronic
970950514 4:21750083-21750105 CATCCTCCTCCCTCTCTCCAGGG + Intronic
974522456 4:63000756-63000778 CACCCTTCTCCCTCAGTCTTGGG - Intergenic
975530665 4:75396273-75396295 GAGCCTTGTCCTTCTGTCCTTGG - Intergenic
976113697 4:81703634-81703656 CCAACTTCTCCCTCTGTCCAAGG + Intronic
977891050 4:102312009-102312031 CATTCTTCTTCCTCTGTGCCAGG + Intronic
978056447 4:104274130-104274152 GAGCATTCTGCCTTTGTCCCTGG + Intergenic
979558611 4:122077922-122077944 CGGCCTCCTCCAGCTGTCCCTGG - Intergenic
980517306 4:133879362-133879384 CAGCCTTATCCCCCTTTCACTGG + Intergenic
981429942 4:144646541-144646563 CCGCCACCTCCCTCTGTCTCTGG + Exonic
981938226 4:150256185-150256207 CACCCTCCTCCCGCTGCCCCGGG + Exonic
982225160 4:153158150-153158172 TTACCTTCTCTCTCTGTCCCTGG - Intronic
983070885 4:163266236-163266258 CAGTCTTAGCCCTCTGACCCTGG - Intergenic
984751882 4:183286073-183286095 CAGCCACGTCCCACTGTCCCTGG + Intronic
985717757 5:1472156-1472178 CAGAGTTCTCCCTCTGCCCTTGG - Intronic
985717902 5:1472955-1472977 CAGCCTCCTTCCCCTGTCCTGGG + Intronic
985731233 5:1550180-1550202 TGGCTTTCTCCCTCTGCCCCTGG + Intergenic
985759258 5:1736686-1736708 CGGCCCTCCTCCTCTGTCCCAGG + Intergenic
986280422 5:6317549-6317571 CAGCCTTCAGCCACTTTCCCAGG - Intergenic
990139812 5:52690220-52690242 CAGCCATGACCCTCTGCCCCAGG + Intergenic
992504635 5:77374894-77374916 CAGCTGTCTCCCTCTGTAGCAGG + Intronic
993252754 5:85549848-85549870 CAGCCTCCTCCCGCTGTTTCCGG - Intergenic
994060685 5:95473323-95473345 TTGCCTTCTCACTCTCTCCCGGG - Intronic
994888479 5:105598510-105598532 CAGGGGTCTCACTCTGTCCCCGG + Intergenic
997877214 5:137560118-137560140 CTTCCTTCTCCCTCTGCTCCAGG + Intronic
998848665 5:146334521-146334543 CACCCTACTCCCTCGGACCCTGG + Intronic
999244678 5:150147534-150147556 CAGCCTTCCCCCACAGGCCCAGG + Intronic
999370466 5:151052178-151052200 CAGCCTGATCCCGCTGTTCCAGG + Exonic
1002091701 5:176810251-176810273 CAGACTCCTGCCCCTGTCCCTGG + Intergenic
1002204521 5:177553829-177553851 CAGCCTCTTCCCTCTGCCCCCGG - Intronic
1002621154 5:180489450-180489472 CAACATTCTCCATCAGTCCCAGG + Intergenic
1003683954 6:8282496-8282518 CAGCCGGCTCCCTCTGTTCGCGG + Intergenic
1004385648 6:15170437-15170459 CAGCCACCTCCCCCAGTCCCAGG - Intergenic
1005619397 6:27606032-27606054 CTGCCCTCTCCCTCTGACCCAGG + Intergenic
1005803021 6:29445963-29445985 AATCCTTCTCCTTATGTCCCTGG - Intronic
1006402466 6:33825861-33825883 CAGCGCTCTCCCTTCGTCCCAGG - Intergenic
1006835841 6:36998422-36998444 CTGCCGTCTCCCAGTGTCCCGGG + Intergenic
1007467710 6:42066338-42066360 CAGCCTTCTCCCGCAGGACCTGG - Exonic
1008088170 6:47266172-47266194 CAGACTTCTCCCTCTTTCTAGGG - Intronic
1008300578 6:49833912-49833934 CAGCCTACTTACTGTGTCCCAGG + Intergenic
1008487655 6:52053130-52053152 CAACCTTCTCCCTCTGGCCCAGG - Exonic
1010783714 6:79975090-79975112 CAGTCTTGTCCCTCTCTACCAGG + Intergenic
1011677980 6:89754139-89754161 CAGCCTTCGGACTCTGTGCCGGG - Exonic
1011746561 6:90412801-90412823 GAGCCTCCTCACTCTGTTCCTGG - Intergenic
1012460369 6:99454023-99454045 CAGCTTTCTCCCTTTTGCCCAGG - Intronic
1013308592 6:108872634-108872656 CAGCCTTATCCCTTTATCCCAGG + Intronic
1013481340 6:110555417-110555439 CCGCCTCCTCCTTCTGTCCCAGG - Intergenic
1013817994 6:114122057-114122079 CAGACATCACCCCCTGTCCCTGG + Intronic
1017135962 6:151147726-151147748 AAGCCTTTTCCCTCTGTCGGGGG + Intergenic
1017760161 6:157562415-157562437 CTGCCTTGTTCCGCTGTCCCTGG + Intronic
1018443277 6:163833059-163833081 CAGCCTAATTCCTCTTTCCCAGG + Intergenic
1018715839 6:166532270-166532292 CAGCCATGTCCCTCTGCCCATGG - Intronic
1018716437 6:166536310-166536332 CAGTGTTGTCCTTCTGTCCCTGG + Intronic
1019022147 6:168928260-168928282 GTGCCTTTTCCCTCGGTCCCAGG + Intergenic
1019277102 7:181578-181600 CCGTCTTCTCCGGCTGTCCCTGG + Intergenic
1019357754 7:589868-589890 CCGGCTCCTCTCTCTGTCCCGGG - Intronic
1019443774 7:1060478-1060500 CACCCTACCCCCACTGTCCCTGG - Intronic
1020115557 7:5474165-5474187 CAGCCCCCTCCCTCAGCCCCAGG - Intronic
1020997077 7:15278717-15278739 CAGCCTACTCACTCCCTCCCTGG + Intronic
1025027301 7:55527061-55527083 CTGCCCTCTGCTTCTGTCCCTGG - Intronic
1025766864 7:64464035-64464057 CAGCCCCCTCCCTCTCTCTCGGG - Intergenic
1026128702 7:67602566-67602588 CAACCTTCTCCCACTGCCCATGG - Intergenic
1026883446 7:73921777-73921799 CAGCCATATCTCTCTGTCCTGGG + Intergenic
1029274843 7:99397889-99397911 CAGCCTCCTCCCGCTGTTTCCGG + Exonic
1029414360 7:100433708-100433730 CAGCCTCCTCCCTATGCCTCTGG + Exonic
1029945894 7:104532534-104532556 CTTTCTTCTCCCTCTGACCCTGG + Intronic
1031007933 7:116495845-116495867 CACCTTTCTCCTTCTTTCCCAGG - Intronic
1031077763 7:117229207-117229229 CCGCCTTCTCCCAGGGTCCCAGG + Intronic
1031596104 7:123650851-123650873 CAGCTGTCTGCCTCTCTCCCAGG + Intergenic
1031957184 7:127954527-127954549 CAGCCCTCTCTCTCTTTCCCTGG + Intronic
1032259328 7:130322324-130322346 CAGCCTGATCCCTATGTCTCAGG - Intronic
1033363241 7:140652713-140652735 CCGCCTTCTCACTGTGTCCGTGG - Intronic
1033453669 7:141483351-141483373 CAGCCATGGCCCTCTTTCCCCGG + Intergenic
1033661872 7:143408304-143408326 GAGGCAGCTCCCTCTGTCCCTGG + Intronic
1034219506 7:149432938-149432960 CGACTTTCTCTCTCTGTCCCTGG - Intronic
1034410083 7:150936236-150936258 CCTCCGTCTCCCTCTGGCCCCGG + Intergenic
1034844723 7:154433667-154433689 TAGTCTTCTCCTTCTGTCCTAGG + Intronic
1035266362 7:157692181-157692203 CCGCCGTCTCCAGCTGTCCCGGG - Intronic
1036698868 8:10997859-10997881 TTGCCTTCCCCCTCTGACCCCGG - Intronic
1036712243 8:11087471-11087493 CAGCCTTCTCCATGTCTCCTTGG - Intronic
1037581258 8:20247181-20247203 CAGCCTTCTCCATATCTCCATGG - Exonic
1037829070 8:22177545-22177567 CCGCCTCCTCCCTCTCTCCCAGG + Intronic
1037880261 8:22570203-22570225 CCTTCTTCCCCCTCTGTCCCTGG - Intronic
1038028575 8:23615876-23615898 CAGTCTTCTTCCTCCATCCCAGG + Intergenic
1038965065 8:32562598-32562620 CAGCCCTCTCAGTCTGGCCCAGG - Intronic
1040414669 8:47185649-47185671 TTTCCTTCTCCCTCTGCCCCTGG + Intergenic
1040490245 8:47914006-47914028 CAGCCGCTTCTCTCTGTCCCAGG + Exonic
1041830461 8:62147575-62147597 CAGCCTTCTCTCCCCCTCCCTGG - Intergenic
1044648914 8:94474623-94474645 GAGCCTTCACCCCCTGGCCCTGG + Intronic
1046531131 8:115446483-115446505 CAGCCTTCTGCCTCAGGCCCAGG - Intronic
1048083222 8:131150968-131150990 CAGCCCTCTCCCTGGTTCCCAGG - Intergenic
1048226391 8:132590390-132590412 CCAACTTCTCCCTCTGTCCCAGG + Intronic
1048880239 8:138866656-138866678 CAGCCACATCACTCTGTCCCTGG - Intronic
1049021484 8:139960421-139960443 GAGCCCTCTCCCTCTGTACCTGG + Intronic
1049164364 8:141117214-141117236 CTGCCTCCTCCCTCTGCCCAGGG + Intergenic
1049428793 8:142549752-142549774 CAGCCTGCTCCCTGTGGCCCCGG + Intergenic
1049501924 8:142971602-142971624 TGGGCTTCTCCCTCTGCCCCAGG + Intergenic
1050594388 9:7191667-7191689 CAACCTGCTGCCTCTGTCACTGG - Intergenic
1053307406 9:36994336-36994358 AAGCCTGCGCCCTCTGTGCCTGG + Intronic
1053392524 9:37746077-37746099 CTGTCTTCTTCCTCTGTCTCAGG - Exonic
1053473065 9:38360535-38360557 CAGCCTTTTCCCTGGCTCCCTGG - Intergenic
1053669820 9:40348666-40348688 CAGCCAGCTCCCCGTGTCCCCGG + Intergenic
1053919618 9:42974921-42974943 CAGCCAGCTCCCCATGTCCCCGG + Intergenic
1054380952 9:64488667-64488689 CAGCCAGCTCCCCGTGTCCCCGG + Intergenic
1054514792 9:66027630-66027652 CAGCCAGCTCCCCGTGTCCCCGG - Intergenic
1055130591 9:72769930-72769952 CATGCTTGTTCCTCTGTCCCAGG - Intronic
1055154301 9:73041637-73041659 TTGCCTACTCCCTCTGTCCTTGG - Intronic
1055305725 9:74927385-74927407 CAGTCTACTTCCTCTGCCCCTGG - Intergenic
1055967535 9:81880370-81880392 GAACCTTCTCCCTCTGCCACTGG + Intergenic
1056988563 9:91388267-91388289 GAGTCTTCTCCCAATGTCCCAGG + Intergenic
1057522588 9:95772035-95772057 CAGCCTTCTCCGACAGTGCCGGG + Intergenic
1057794062 9:98143196-98143218 CTGTCTTCCCCCTCTGCCCCAGG - Intronic
1058132631 9:101269994-101270016 AAGCTTTCTTCCTCTGTCCCTGG - Exonic
1058514129 9:105752159-105752181 CAGGGTTCTCCATCTCTCCCTGG + Intronic
1058735335 9:107888941-107888963 CAGCCCTCTCCTTCTGCCCAGGG + Intergenic
1058905150 9:109476857-109476879 CTGCCTTCTTTCTCAGTCCCTGG + Intronic
1059056228 9:110983481-110983503 CATCCCTCTCCCCCAGTCCCTGG - Intronic
1059361116 9:113742682-113742704 CAGCCATCTCACTCTCCCCCTGG - Intergenic
1059426257 9:114222670-114222692 CTACCTTCTCCCTCTGGACCTGG - Intronic
1059436702 9:114281505-114281527 CTGCCTTCTCCCACTTTCCTTGG - Intronic
1061182256 9:129031605-129031627 CTGCCTCCTGCCTCTGTCACAGG - Intergenic
1061310875 9:129761683-129761705 CCGCCCTCTCCTTCTGTCTCTGG + Intergenic
1061510835 9:131059995-131060017 CAGGCTTCTCACTCAGTCCCTGG + Intronic
1061572093 9:131484225-131484247 CAGCCTTCCCTGTCTGGCCCAGG + Intronic
1061576610 9:131511315-131511337 CAACCTTCTGCTTCTGTCTCAGG + Exonic
1203439628 Un_GL000195v1:176694-176716 CTGGCTTCTCCTTCTGTTCCTGG + Intergenic
1185447656 X:267999-268021 CAGCTTTGTGCCTCTGTTCCCGG + Intergenic
1187183875 X:16966120-16966142 CAGCCCTCTCCCTCTCCCCACGG - Intronic
1189265730 X:39714784-39714806 CATGCCTCTCCCTCTGTCCATGG + Intergenic
1189697269 X:43677107-43677129 CTGCCTTCTCCACCTCTCCCAGG - Intronic
1189883368 X:45514300-45514322 CTGCCTGCTCCCTCTTTCCAAGG - Intergenic
1191991202 X:67038845-67038867 CAGTGTGCTCCCTCTGGCCCAGG + Intergenic
1193623423 X:83786218-83786240 CTGCCTTCCCCCTTTGTCTCTGG - Intergenic
1195959866 X:110374991-110375013 CAGCCTTCTTGCTCTTTCCTGGG - Intronic
1196221826 X:113120085-113120107 CATCCTTCTCTTTCTGTCCTAGG - Intergenic
1196555835 X:117083797-117083819 GAGCTCTGTCCCTCTGTCCCTGG + Intergenic
1197375856 X:125681462-125681484 CTGCCATCTTGCTCTGTCCCTGG - Intergenic
1198243164 X:134804108-134804130 CAGTCTGCTGCGTCTGTCCCAGG - Intronic
1198768144 X:140099259-140099281 CAGGCTTCCCCCTCTGGCCAGGG - Intergenic