ID: 1101866648

View in Genome Browser
Species Human (GRCh38)
Location 12:108525157-108525179
Sequence GCCCGTATGCTGCTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101866638_1101866648 21 Left 1101866638 12:108525113-108525135 CCTGGGACAGAGGGAGAAGGCTG 0: 1
1: 0
2: 7
3: 61
4: 497
Right 1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG 0: 1
1: 0
2: 0
3: 2
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101866648 Original CRISPR GCCCGTATGCTGCTGGTCAC AGG Intronic
900655256 1:3753772-3753794 CCACACATGCTGCTGGTCACAGG - Intronic
900844076 1:5082218-5082240 GCCCATTTGCTGCTGTTCTCAGG + Intergenic
902379082 1:16044219-16044241 CCCAGTCTGCTGCTGGACACAGG + Intronic
904277005 1:29391312-29391334 CCCTGTCTGCTGCTAGTCACTGG + Intergenic
904965880 1:34372231-34372253 CCCTGTATGCAGCTGCTCACAGG - Intergenic
906102659 1:43273083-43273105 GGCCTCGTGCTGCTGGTCACCGG + Exonic
907301226 1:53487494-53487516 GCCATCATGCTTCTGGTCACTGG + Intergenic
909356395 1:74714858-74714880 GGCACTATGCTGCTGGACACTGG + Intronic
911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG + Intronic
913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG + Intronic
914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG + Intergenic
914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG + Intergenic
914615639 1:149352412-149352434 ACCAGTATGCTACTGGTCAGAGG - Intergenic
920203852 1:204277285-204277307 GCCAGAATGCTACTGGTCAGAGG + Intronic
921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG + Intergenic
921603508 1:217132651-217132673 GCCTGTATGCAGATGGGCACAGG + Intronic
923072122 1:230575419-230575441 ACATGGATGCTGCTGGTCACTGG - Intergenic
1076496899 10:130903530-130903552 GCCAGGAAGCTGCTGGTCCCAGG - Intergenic
1083772418 11:64875700-64875722 GCCCGTGGGCCCCTGGTCACTGG - Intronic
1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG + Intronic
1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG + Exonic
1094221621 12:28000050-28000072 GCCTGCATGCAGCTGGTCAGAGG - Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1115439668 14:33418385-33418407 GCTTGTATGCTGCTGGTAGCAGG + Intronic
1119415315 14:74465771-74465793 GCCCTCATGCTGATGTTCACAGG - Intergenic
1122609229 14:102969764-102969786 GCCCGTAGCCTGCTGCTGACTGG - Intronic
1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG + Intergenic
1135691258 16:24539695-24539717 GCCCGCAAGCTGCTGGGCAGCGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG + Intronic
1148018388 17:44538461-44538483 GCTGGTATGCTGCTGGTGAGGGG - Intergenic
1152058651 17:78052066-78052088 GCCCTTGTCCTGCTGGACACAGG - Intronic
1152190235 17:78883653-78883675 GCACGTGAGCTGCTGGCCACTGG + Intronic
1161013568 19:1971629-1971651 CCCCGCAGGCTGCAGGTCACGGG - Intronic
1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG + Intronic
1163817851 19:19477803-19477825 GCCCCTAGACTGCTGGTCTCCGG - Intronic
1164591487 19:29510002-29510024 TCGCGGATGGTGCTGGTCACAGG - Intergenic
930097544 2:47577555-47577577 GACTGTATGGTGCTGGTCACGGG + Intergenic
935528065 2:104197207-104197229 GCTTGCCTGCTGCTGGTCACAGG + Intergenic
937952662 2:127400842-127400864 GCCCCTCTGCTGCTGGGAACCGG + Intergenic
942953586 2:181749792-181749814 GCCCCTTTGCTGCAGGTCGCTGG + Intergenic
948748568 2:240113406-240113428 GCCCGGAGGCTGCTGGGCAAGGG + Intergenic
1175812491 20:61866022-61866044 GCCAGGATGCTGGTGGTGACAGG - Intronic
1181508865 22:23379924-23379946 TCCCTGAGGCTGCTGGTCACAGG - Intergenic
1185156457 22:49196114-49196136 GCCTGTTTGCTGATGGTGACTGG - Intergenic
1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG + Intronic
953882728 3:46700048-46700070 TTCCTCATGCTGCTGGTCACAGG - Intergenic
958532929 3:95357396-95357418 CCCCCTATGCTGCCGTTCACTGG + Intergenic
968597318 4:1492147-1492169 GCCCCTGTGCTGCTGGTAACAGG - Intergenic
969245656 4:5931084-5931106 TCCCGGATCCTGCAGGTCACTGG + Intronic
969286574 4:6206201-6206223 GCCTTCATGCTGCTGTTCACTGG - Intergenic
970053540 4:11945155-11945177 GCCTTGCTGCTGCTGGTCACTGG + Intergenic
975787632 4:77908864-77908886 TCCTGTAGGCTGCTGGACACAGG + Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976407544 4:84677303-84677325 GCCGTTCTGCTGCTGATCACTGG - Exonic
984254321 4:177372620-177372642 TCCCATCTGCTGCTGGTCTCTGG - Intergenic
985517552 5:354714-354736 TGCCACATGCTGCTGGTCACGGG - Intronic
988708880 5:33753926-33753948 GCAAGTAGGCTGCTGGTCCCAGG + Intronic
992093356 5:73339008-73339030 GCCCGTATCCTGCTGGTTCAGGG - Intergenic
997930035 5:138065218-138065240 GTCCGCATGCTGCTGGTAGCTGG - Intergenic
998659269 5:144218154-144218176 GACCATATGCTTCTGTTCACAGG - Intronic
999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG + Intronic
999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG + Intergenic
1004310354 6:14540043-14540065 GCCCGTATGAGGCTGGGCGCTGG - Intergenic
1015226066 6:130858974-130858996 GCTCCTATCCTGCTGCTCACAGG - Intronic
1019145272 6:169971862-169971884 GCCCGGGTCCTGCTTGTCACTGG + Intergenic
1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG + Intergenic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1029494172 7:100888308-100888330 CCCCGTATGGTGCTGGTCGAGGG + Exonic
1032687735 7:134252659-134252681 GCCCATGTGCTGCTGGGCATAGG - Intronic
1033607687 7:142939561-142939583 GCACGGATCCTGCTGGGCACTGG + Exonic
1035575670 8:703123-703145 CCCCGAATGCTCCTGGTTACAGG - Intronic
1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG + Intronic
1043701889 8:83299314-83299336 GCCCATCTGCTTCTGGTCATGGG + Intergenic
1056454148 9:86744243-86744265 GCCCGTTTCCTTTTGGTCACTGG + Intergenic
1059281117 9:113135064-113135086 GCACTGATGCTGCTGGTCCCTGG - Intergenic
1059560842 9:115333323-115333345 GCCCCTACTCTCCTGGTCACTGG - Intronic
1060552708 9:124493037-124493059 GGCAGCATCCTGCTGGTCACCGG - Exonic
1062179633 9:135184336-135184358 GCCCGGAGGCTGCTGGGCAGTGG - Intergenic